Glyma14g36150 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g36150

Feature Type:	gene_model
Chromosome:	Gm14
Start:	45351002
stop:	45356038
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g36150

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G24470	AT	Annotation by Michelle Graham. TAIR10: GATA-type zinc finger protein with TIFY domain \| chr4:12645785-12647734 FORWARD LENGTH=309	SoyBase	E_val: 3.00E-86	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007623	GO-bp	Annotation by Michelle Graham. GO Biological Process: circadian rhythm	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF00320	PFAM	GATA zinc finger	JGI		ISS
PF06200	PFAM	tify domain	JGI		ISS
PF06203	PFAM	CCT motif	JGI		ISS
UniRef100_G7JYF5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: GATA transcription factor n=1 Tax=Medicago truncatula RepID=G7JYF5_MEDTR	SoyBase	E_val: 2.00E-119	ISS
UniRef100_I1MB13	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MB13_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma14g36150

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g36150

Paralog	Evidence	Comments
Glyma02g37980	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g36150 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g182800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g36150

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g36150

Limit To All Plant Sequences

>Glyma14g36150.1   sequence type=CDS   gene model=Glyma14g36150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGCCATCAGCAATGTACGGACACTCCCAGCCCCTGAGCATGCCCTCGCAGATCGGCGGCGGCGAAAGCGACGACGGCTCCGGAAACGAGCACGCCGTCGACGGCCACCACCACCACATTCAGTACGAAACGCACGCGCTCGAGGACGGTGCCGCCGTCGTCGTCGAGGATGTTACCTCGGATGCGGTCTATGTCTCCGGCGGTGGAGGCCCCGTAGAGTCCAGCCAGCTTACGCTGTCGTTTCGTGGCCAAGTGTACGTCTTCGATGCCGTTACGCCTGATAAGGTTCAAGCGGTGTTGTTACTGTTGGGTGGATGTGAACTATCTTCAGGTGGTTCGCCATGTGTGGATCCGGGGGCTCAACATAATCAAAGGGGTTCAATGGAATTTCCTAAATGTAGTCTACCACACCGAGCTGCCTCATTACATAGGTTCAGGCAGAAGAGGAAAGAGCGATGCTTTGACAAAAAAGTGAGATATAGCGTGCGGCAAGAAGTTGCGCTCAGGATGCACCGTAACAAGGGCCAGTTTACTTCATCTAAGAAACAAGATGGAGCTAATAGTTATGGTACTGACCAAGATTCAGGACAGGATGATAGTCAATCCGAAACCTCATGTACACATTGTGGCATTAGTTCAAAATCCACCCCAATGATGCGGCGAGGGCCATCTGGTCCAAGGTCACTTTGCAACGCTTGTGGGCTTTTTTGGGCAAATAGGGGTGCTTTGCGAGACCTTTCTAAGAGAAATCAGGAACACTCTCTTCCACCAGTTGAGCAGGTTGATGAAGGTAATGACTCGGACTGTCGGACTGCCACTGCCGACCCTGCACATAACAATCTTCCTGCTTTCTCAGAGCATGATAATCCAGCTTTGGTAGCTGATCATAAAGTTTTCCAGTCTCAGAAAATGTTGAAGTAG

Predicted protein sequences of Glyma14g36150

Limit To All Plant Sequences

>Glyma14g36150.1   sequence type=predicted peptide   gene model=Glyma14g36150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEPSAMYGHSQPLSMPSQIGGGESDDGSGNEHAVDGHHHHIQYETHALEDGAAVVVEDVTSDAVYVSGGGGPVESSQLTLSFRGQVYVFDAVTPDKVQAVLLLLGGCELSSGGSPCVDPGAQHNQRGSMEFPKCSLPHRAASLHRFRQKRKERCFDKKVRYSVRQEVALRMHRNKGQFTSSKKQDGANSYGTDQDSGQDDSQSETSCTHCGISSKSTPMMRRGPSGPRSLCNACGLFWANRGALRDLSKRNQEHSLPPVEQVDEGNDSDCRTATADPAHNNLPAFSEHDNPALVADHKVFQSQKMLK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain