SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G30190 | AT | Annotation by Michelle Graham. TAIR10: H(+)-ATPase 2 | chr4:14770820-14775920 REVERSE LENGTH=948 | SoyBase | E_val: 1.00E-74 | ISS |
| GO:0006200 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP catabolic process | SoyBase | N/A | ISS |
| GO:0006754 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP biosynthetic process | SoyBase | N/A | ISS |
| GO:0006812 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cation transport | SoyBase | N/A | ISS |
| GO:0006857 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oligopeptide transport | SoyBase | N/A | ISS |
| GO:0006865 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid transport | SoyBase | N/A | ISS |
| GO:0006888 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport | SoyBase | N/A | ISS |
| GO:0008152 | GO-bp | Annotation by Michelle Graham. GO Biological Process: metabolic process | SoyBase | N/A | ISS |
| GO:0010167 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to nitrate | SoyBase | N/A | ISS |
| GO:0015706 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nitrate transport | SoyBase | N/A | ISS |
| GO:0015991 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport | SoyBase | N/A | ISS |
| GO:0043090 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid import | SoyBase | N/A | ISS |
| GO:0052541 | GO-bp | Annotation by Michelle Graham. GO Biological Process: plant-type cell wall cellulose metabolic process | SoyBase | N/A | ISS |
| GO:0052546 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell wall pectin metabolic process | SoyBase | N/A | ISS |
| GO:0005774 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane | SoyBase | N/A | ISS |
| GO:0005794 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009506 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0016021 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane | SoyBase | N/A | ISS |
| GO:0000166 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: nucleotide binding | SoyBase | N/A | ISS |
| GO:0000287 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding | SoyBase | N/A | ISS |
| GO:0003824 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: catalytic activity | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0005524 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATP binding | SoyBase | N/A | ISS |
| GO:0008553 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: hydrogen-exporting ATPase activity, phosphorylative mechanism | SoyBase | N/A | ISS |
| GO:0015662 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism | SoyBase | N/A | ISS |
| GO:0016887 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATPase activity | SoyBase | N/A | ISS |
| GO:0046872 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: metal ion binding | SoyBase | N/A | ISS |
| PTHR24093 | Panther | FAMILY NOT NAMED | JGI | ISS | |
| PTHR24093:SF61 | Panther | SUBFAMILY NOT NAMED | JGI | ISS | |
| UniRef100_I1MGZ2 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MGZ2_SOYBN | SoyBase | E_val: 3.00E-91 | ISS |
| UniRef100_Q7Y067 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Plasma membrane H+-ATPase n=2 Tax=Sesbania rostrata RepID=Q7Y067_SESRO | SoyBase | E_val: 1.00E-83 | ISS |
|
Glyma14g33601 not represented in the dataset |
Glyma14g33601 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.14g165600 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma14g33601.1 sequence type=CDS gene model=Glyma14g33601 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTCCCTGTGTAACCTCAGGGATGATGCTAAGAAAAAGGTTCATGCTATTATTGACAAGTTTGCTAAAAGAGGGCTTCGTTCACTTGTTGTTACTAAACAAAAAATAAAAGAAAGTGTTGGTGCTCCATGGCAGTTTGTTGGCATGTTGTCACTGTTTGATCCCCCTAGGCCTGATAATGATGAAACAATTCGCCGAGCTCTTAACCTTGGTGTGAATGTTAAGATGATTACATGTGATCAAATTGCCATAACTAAGGAAAAAGGAAGGGGACTTGGAATGGAAACAAATATGTACCCATCTGCTTCATTGCTTGGTCAACACAAAGATGCAAGTATTGCCGCACTTCCTGTAGAAGAGCTGATTAAGAAGGCAAATGGATTCGTTGGAGTTTTTCCAGGAACAATCATGACAATTTCAAAGGACATGGTTAAGCCATCTCCCATGCCTGATAACTGGAAACTAAATGAAATCTTTGCTACTGGGGTTGTGCTTGGAGGTTACTTGGCACTGATGGTTTTTATATTCTTTTGGGCAATCAAAGAGACAACATTCTTCCCTTTAGATCATGACAATCTATATGAAATGACTGCTTCTTTGTATCTACAAGTCAGTATAGTTAGTCAGACTTTGATACTTTTCACCCATTCGCACATCTGGTCCTACATCGAACGCCCTCAATTGCCGTTAGTGGTTGCTTTCATTATTGCTCAGCCAGAATTTGTTGGGGTGATTTGGCTTTACAGTATTGTCTTCTATTTCCCACTTCACCTCATGAAGTTCACTATCCACTACATCTTGAGTGGAAAAGCATGGAACAATCTCCTAGAAAGCAAGAAAGACTATGGTAAAGAGGAGAGGGAAGCTCAATGGGCTCTTGCTCAAAGGACCATGCATGGACTTAAACCTCCAAAAACTTCTAATATCTTCAATGAAAAGAGAAATTATAGAGAACTCACTGAGATTGCTGAGTAG
>Glyma14g33601.1 sequence type=predicted peptide gene model=Glyma14g33601 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MSLCNLRDDAKKKVHAIIDKFAKRGLRSLVVTKQKIKESVGAPWQFVGMLSLFDPPRPDNDETIRRALNLGVNVKMITCDQIAITKEKGRGLGMETNMYPSASLLGQHKDASIAALPVEELIKKANGFVGVFPGTIMTISKDMVKPSPMPDNWKLNEIFATGVVLGGYLALMVFIFFWAIKETTFFPLDHDNLYEMTASLYLQVSIVSQTLILFTHSHIWSYIERPQLPLVVAFIIAQPEFVGVIWLYSIVFYFPLHLMKFTIHYILSGKAWNNLLESKKDYGKEEREAQWALAQRTMHGLKPPKTSNIFNEKRNYRELTEIAE*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
