Glyma14g33150 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g33150

Feature Type:	gene_model
Chromosome:	Gm14
Start:	40596355
stop:	40598487
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g33150

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G21930	AT	Annotation by Michelle Graham. TAIR10: unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G42150.3); Has 43 Blast hits to 43 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). \| chr1:7713466-7714298 FORWARD LENGTH=98	SoyBase	E_val: 3.00E-45	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005575	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cellular component	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_I1MAK6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MAK6_SOYBN	SoyBase	E_val: 2.00E-61	ISS
UniRef100_Q2QQW1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=2 Tax=Oryza sativa RepID=Q2QQW1_ORYSJ	SoyBase	E_val: 2.00E-43	ISS

Expression Patterns of Glyma14g33150

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g33150

Paralog	Evidence	Comments
Glyma13g02780	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g33150 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g162800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g33150

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g33150

Limit To All Plant Sequences

>Glyma14g33150.1   sequence type=CDS   gene model=Glyma14g33150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGGTGAAGAAAATGTAAAGCATCTTGAAGATTGTTCTGTTTCCAATGCATTGGGCACTTGGGTATTCTCAGTTGCAGGAGCTTTGCTGGCTATTCCAGTGGGGATAAAGCGCAAATCTCTGGCACCCCTTGTATTTTTTGGCACCACTGGTACTATGTTGGATATTATTATGGGAATTAGTGCTTGCGAAAGGGAACATGCAGAGCGCCAAATGAAGTTACTTGAAGCGCAAAATGCTGCTGCCGAGACTTCTTTGGGTGAAACAGAAATTGATTCATAA

Predicted protein sequences of Glyma14g33150

Limit To All Plant Sequences

>Glyma14g33150.1   sequence type=predicted peptide   gene model=Glyma14g33150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGGEENVKHLEDCSVSNALGTWVFSVAGALLAIPVGIKRKSLAPLVFFGTTGTMLDIIMGISACEREHAERQMKLLEAQNAAAETSLGETEIDS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain