Glyma14g29060 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g29060): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g29060): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g29060

Feature Type:	gene_model
Chromosome:	Gm14
Start:	35704088
stop:	35705708
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g29060

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G20990	AT	Annotation by Michelle Graham. TAIR10: synaptotagmin A \| chr2:9014827-9017829 FORWARD LENGTH=579	SoyBase	E_val: 1.00E-42	ISS
GO:0001778	GO-bp	Annotation by Michelle Graham. GO Biological Process: plasma membrane repair	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006897	GO-bp	Annotation by Michelle Graham. GO Biological Process: endocytosis	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009615	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to virus	SoyBase	N/A	ISS
GO:0032456	GO-bp	Annotation by Michelle Graham. GO Biological Process: endocytic recycling	SoyBase	N/A	ISS
GO:0046740	GO-bp	Annotation by Michelle Graham. GO Biological Process: spread of virus in host, cell to cell	SoyBase	N/A	ISS
GO:0005768	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endosome	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0009898	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: internal side of plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PTHR10774	Panther	CALCIUM-DEPENDENT LIPID-BINDING PROTEIN (CALB RELATED)	JGI		ISS
PTHR10774:SF2	Panther	CALCIUM LIPID BINDING PROTEIN	JGI		ISS
UniRef100_G7I517	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Synaptotagmin-1 n=1 Tax=Medicago truncatula RepID=G7I517_MEDTR	SoyBase	E_val: 3.00E-63	ISS
UniRef100_UPI000233B6D2	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B6D2 related cluster n=1 Tax=unknown RepID=UPI000233B6D2	SoyBase	E_val: 1.00E-87	ISS

Expression Patterns of Glyma14g29060

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g29060 not represented in the dataset	Glyma14g29060 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g29060 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma14g29060

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g29060

Limit To All Plant Sequences

>Glyma14g29060.1   sequence type=CDS   gene model=Glyma14g29060   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGTTCGTGAGCAGTTTCTTGGGGGTTCTTGGTTTTGCCGTTGGAATACCTCTTGGCCTCTTAGTTGGGTTCTTTCTCTTTGTCTACTCAAAAACCAAACATGTCAAGGACCCTGTTGTTAGGCCAATCAGTGAATTAGGCCCAAATGCTCTGCAGGAACTTCTGCCCGAGATTCCTCTCTGGGTGAAGACGCCTGATTATGAACGAGTTGATTGGTTGAACAAGTTTTTGTTGGATATGTGGCCCTTCTTAGACACGGCAATTTGTAAGATTATTAGAAGCACGACTCAACCGATATTTGCCGAATACACTGGGAAGTATCAGATCAAAGCGATTGATTTTGATGAGTTAAGCCTTGGTACTCTTCCTCCTACTGTCTGTGTTTTCTGCCCAGTAATACAAATACATGAACGAGAAGCAGAGAAGGTTGTGTTGAGACTTAAGAGTCTTGGAAGCTTTGGATGGGTGATAATTTCTTGTATGTATTTGATCGATGCCCTATACAGAGCTTACACTTTATGCAAATTTCTCACTACTAAATACTATTTGGTCATAGATTTGAGCATCTATCAGCTTTTACTCTTAAGAATC

Predicted protein sequences of Glyma14g29060

Limit To All Plant Sequences

>Glyma14g29060.1   sequence type=predicted peptide   gene model=Glyma14g29060   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGFVSSFLGVLGFAVGIPLGLLVGFFLFVYSKTKHVKDPVVRPISELGPNALQELLPEIPLWVKTPDYERVDWLNKFLLDMWPFLDTAICKIIRSTTQPIFAEYTGKYQIKAIDFDELSLGTLPPTVCVFCPVIQIHEREAEKVVLRLKSLGSFGWVIISCMYLIDALYRAYTLCKFLTTKYYLVIDLSIYQLLLLRI

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain