SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g28652

Feature Type:gene_model
Chromosome:Gm14
Start:35226183
stop:35228141
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g28652
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G21360AT Annotation by Michelle Graham. TAIR10: glycolipid transfer protein 2 | chr1:7481365-7483237 FORWARD LENGTH=223 SoyBaseE_val: 5.00E-79ISS
GO:0046836GO-bp Annotation by Michelle Graham. GO Biological Process: glycolipid transport SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0017089GO-mf Annotation by Michelle Graham. GO Molecular Function: glycolipid transporter activity SoyBaseN/AISS
GO:0051861GO-mf Annotation by Michelle Graham. GO Molecular Function: glycolipid binding SoyBaseN/AISS
KOG3221 KOG Glycolipid transfer protein JGI ISS
PTHR10219Panther GLYCOLIPID TRANSFER PROTEIN-RELATED JGI ISS
PTHR10219:SF4Panther HET-C JGI ISS
PF08718PFAM Glycolipid transfer protein (GLTP) JGI ISS
UniRef100_G7J670UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pleckstrin homology domain-containing protein n=1 Tax=Medicago truncatula RepID=G7J670_MEDTR SoyBaseE_val: 4.00E-102ISS
UniRef100_I3SB29UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Lotus japonicus RepID=I3SB29_LOTJA SoyBaseE_val: 2.00E-115ISS

Expression Patterns of Glyma14g28652
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g28652 not represented in the dataset
Glyma14g28652 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g28652 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g123200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g28652
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g28652
>Glyma14g28652.1   sequence type=CDS   gene model=Glyma14g28652   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAGCACTAGGAGAGAAATGGAGAAGAAGTCGGAGATAGGTTCAGCCATTGAAGAGCTTTCTACGATGACCATAGTTAAACCTGGTGAAAATCACGGGTCTGCCCACATCCCCACTAAGCCTTTTCTCTCTGTTTGTTACTTCGTTCTTCAAGTTCTTGATAAGATAGGGCCAACAATGACTGTTATGAGACAAGACGTGCACCAGAATATTAAGACCTTGGAACTGATGCATGAATCAAATCCCTCATTGAACTCGAATTTGGTTGAGATATTGAAGTCAGAAGCAAGAGAAGGCAATGCTAGGAAAGGGTCAAGCTGCAGTAAGGCCCTTGTTTGGCTTACTAGGACCCTGGATTTCGCCTCGTTGTTGTTACACACACTGGCAAAAGATCCTGAAAAGAGAATGGAGCAAGTAGTTGAAGAGGCTTATGATGTAACTTTAAAACCGAGGCATGGATGGATTTCATCTGCTGCTTTCAGAGTGGCTCTAAGACTGGTCCCAGAAAGTAAAACATTCGTAAATATTCTTAAAACTGAAGATGAAAACTATGACACCCTAAAGGAGAACATGCAGATGCTGGTTTCTCTATTTGTGCCTTTTCTTGAGGATATGCATTGTATTCTAAGATTGTACAACTTGGACAAGCTAAAGTCAACCTAA
Predicted protein sequences of Glyma14g28652
>Glyma14g28652.1   sequence type=predicted peptide   gene model=Glyma14g28652   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKSTRREMEKKSEIGSAIEELSTMTIVKPGENHGSAHIPTKPFLSVCYFVLQVLDKIGPTMTVMRQDVHQNIKTLELMHESNPSLNSNLVEILKSEAREGNARKGSSCSKALVWLTRTLDFASLLLHTLAKDPEKRMEQVVEEAYDVTLKPRHGWISSAAFRVALRLVPESKTFVNILKTEDENYDTLKENMQMLVSLFVPFLEDMHCILRLYNLDKLKST*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo