SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g27363

Feature Type:gene_model
Chromosome:Gm14
Start:33569500
stop:33570360
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g27363
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G03520AT Annotation by Michelle Graham. TAIR10: Thioredoxin superfamily protein | chr4:1562585-1564055 REVERSE LENGTH=186 SoyBaseE_val: 4.00E-16ISS
GO:0006662GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol ether metabolic process SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0045454GO-bp Annotation by Michelle Graham. GO Biological Process: cell redox homeostasis SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0008047GO-mf Annotation by Michelle Graham. GO Molecular Function: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0015035GO-mf Annotation by Michelle Graham. GO Molecular Function: protein disulfide oxidoreductase activity SoyBaseN/AISS
KOG0910 KOG Thioredoxin-like protein JGI ISS
PTHR10438Panther THIOREDOXIN-RELATED JGI ISS
PTHR10438:SF82Panther SUBFAMILY NOT NAMED JGI ISS
PF00085PFAM Thioredoxin JGI ISS
UniRef100_Q2PXN7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chloroplast thioredoxin M-type (Fragment) n=1 Tax=Arachis hypogaea RepID=Q2PXN7_ARAHY SoyBaseE_val: 3.00E-48ISS
UniRef100_UPI000233B555UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B555 related cluster n=1 Tax=unknown RepID=UPI000233B555 SoyBaseE_val: 1.00E-74ISS

Expression Patterns of Glyma14g27363
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g27363 not represented in the dataset
Glyma14g27363 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g27363 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g119700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g27363
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g27363
>Glyma14g27363.1   sequence type=CDS   gene model=Glyma14g27363   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTTGGAGAACTGTGTGGCAGTCACCACAGTAGGAACAAGTGCTAGACCTCAATGTCTTCATCCATTCAGCAAAAGGGAAAAGCTTGTTTTCCCCACTTTCAGAGGATTTAAGAAATCTTTGACAAAAACAAAATCTCGTTTTATCTGCAATGCTCGTGAAGCAGTAGATGAAGTGCGAGCTGTGACAGATTCAAGCTGGAATAACATTGTCATTGCAAGTGAGACCCCATTGCACCATGGTGTGTTGGCGAAAGAGTATGCTGGAAAAATTGCATGCTTCAAGCTTAACACTGATGACTGTCCCAACATAGCCACAGAGTATGGAATCAGAAGCATAGCAACTGTTCTGCTCTTCAAAAATGGAGAAAAGAAAGCGTAA
Predicted protein sequences of Glyma14g27363
>Glyma14g27363.1   sequence type=predicted peptide   gene model=Glyma14g27363   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALENCVAVTTVGTSARPQCLHPFSKREKLVFPTFRGFKKSLTKTKSRFICNAREAVDEVRAVTDSSWNNIVIASETPLHHGVLAKEYAGKIACFKLNTDDCPNIATEYGIRSIATVLLFKNGEKKA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo