SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g19670

Feature Type:gene_model
Chromosome:Gm14
Start:22187326
stop:22188197
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g19670
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G31320AT Annotation by Michelle Graham. TAIR10: SAUR-like auxin-responsive protein family | chr4:15193993-15194562 REVERSE LENGTH=189 SoyBaseE_val: 4.00E-57ISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005516GO-mf Annotation by Michelle Graham. GO Molecular Function: calmodulin binding SoyBaseN/AISS
PF02519PFAM Auxin responsive protein JGI ISS
UniRef100_G7I561UniRef Annotation by Michelle Graham. Most informative UniRef hit: Auxin-induced protein 6B n=1 Tax=Medicago truncatula RepID=G7I561_MEDTR SoyBaseE_val: 2.00E-85ISS
UniRef100_UPI000233BF73UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233BF73 related cluster n=1 Tax=unknown RepID=UPI000233BF73 SoyBaseE_val: 6.00E-125ISS

Expression Patterns of Glyma14g19670
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g19670 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g138700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g19670
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g19670
>Glyma14g19670.1   sequence type=CDS   gene model=Glyma14g19670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTTCTATGGATCTAAAGAAATCTAACAAGATCAGAGAAATTGTTAGGCTTCAACAGATCCTCAAGAAATGGAGAAAGTTAGCCAACTCATCAAAAACCACTATGGTTACCACCACCGCTACCGCCACTGTCACCTCTTCCGCCAGCAAGAGCATGAAGTATCTTAAGAGAACACTTTCCCTATCAGAACGTGAAGGAGGGTCAAGCAATGTAGTCCCCAAAGGGTACCTAGCTGTTTGTGTTGGTGAAGAGCTCAAGAGGTTCACTATACCAACTGAATATTTAGGTCATCAAGCCTTTCAGATTCTCCTCAGAGAAGCAGAAGAAGAATTTGGCTTTCAACAAACCGGAGTTCTGAGGATTCCTTGTGAAGTGGCTGTTTTTGAGAGCATCTTGAAGATGGTGGAAGGAAAGGAGGACAAGTTTTCCTCCCAAGAATGTAGACTCAGCATTGAAGAAATGATGATGGGTTACCGCTCCGAAAACCAACTTGCTTATTCTCACCATCCTCAAAGTCCACTGTGCAGATAG
Predicted protein sequences of Glyma14g19670
>Glyma14g19670.1   sequence type=predicted peptide   gene model=Glyma14g19670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSMDLKKSNKIREIVRLQQILKKWRKLANSSKTTMVTTTATATVTSSASKSMKYLKRTLSLSEREGGSSNVVPKGYLAVCVGEELKRFTIPTEYLGHQAFQILLREAEEEFGFQQTGVLRIPCEVAVFESILKMVEGKEDKFSSQECRLSIEEMMMGYRSENQLAYSHHPQSPLCR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo