SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g17811): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g17811): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g17811

Feature Type:gene_model
Chromosome:Gm14
Start:19874297
stop:19875599
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g17811
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G39060AT Annotation by Michelle Graham. TAIR10: Nodulin MtN3 family protein | chr2:16306818-16308206 REVERSE LENGTH=258 SoyBaseE_val: 1.00E-54ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0005887GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0051119GO-mf Annotation by Michelle Graham. GO Molecular Function: sugar transmembrane transporter activity SoyBaseN/AISS
KOG1623 KOG Multitransmembrane protein JGI ISS
PTHR10791Panther STROMAL CELL PROTEIN/NODULIN MTN3-RELATED JGI ISS
PF03083PFAM MtN3/saliva family JGI ISS
UniRef100_G7K8I6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein RUPTURED POLLEN GRAIN n=1 Tax=Medicago truncatula RepID=G7K8I6_MEDTR SoyBaseE_val: 1.00E-57ISS
UniRef100_UPI000233AB6EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233AB6E related cluster n=1 Tax=unknown RepID=UPI000233AB6E SoyBaseE_val: 1.00E-114ISS

Expression Patterns of Glyma14g17811
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g17811 not represented in the dataset
Glyma14g17811 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g17811 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g136000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g17811
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g17811
>Glyma14g17811.1   sequence type=CDS   gene model=Glyma14g17811   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTTCATTTTCTGATCATGAGCTGGTTTTGATCTTTGGTCTCCTAGGTAACATTGTGTCATTCATGGTGTTCTTAGCACCCTTGTCAAACTTCTATACAATTTACAAGAAGAAATCATCTGAGGGTTTTCAATCAATCCCATATGTTGTTGCACTTCTTAGCGCACTATTGCTTCTATATTACGACTTTATAAAGACCAAAGCTACTTTGATTATCACCATCAACTGTATTGGATGTGTTATAGAAGTTTTATACCTAACAATGTACATTATATATGCTCCCAGGAAACAGAAGGCTATCAACCGTGTTCATGCTGTTGGATGGAGTTGCGCCATTTTTAACATTGCAGTGTTCGTTGCTCCCTTAAGCATAATGTTACATTCTATATTCAATTATTCACTGTTCATGCCATTTTCACTGTCCTTGTTTCTTACCCTCTGCGCCATCATGTGGTTTTTATATGGGTTCTTCGACAAGGATGACTTCATTATGGGAGCAGCAAACACTGCAATGTTAAGTGATGCAAATGAAGTGAAAAACTAG
Predicted protein sequences of Glyma14g17811
>Glyma14g17811.1   sequence type=predicted peptide   gene model=Glyma14g17811   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVSFSDHELVLIFGLLGNIVSFMVFLAPLSNFYTIYKKKSSEGFQSIPYVVALLSALLLLYYDFIKTKATLIITINCIGCVIEVLYLTMYIIYAPRKQKAINRVHAVGWSCAIFNIAVFVAPLSIMLHSIFNYSLFMPFSLSLFLTLCAIMWFLYGFFDKDDFIMGAANTAMLSDANEVKN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo