Glyma14g15320 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g15320): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g15320): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g15320

Feature Type:	gene_model
Chromosome:	Gm14
Start:	16267928
stop:	16269450
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g15320

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G06483	AT	Annotation by Michelle Graham. TAIR10: pyruvate dehydrogenase kinase \| chr3:1990727-1992581 REVERSE LENGTH=366	SoyBase	E_val: 9.00E-76	ISS
GO:0030003	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis	SoyBase	N/A	ISS
GO:0046777	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation	SoyBase	N/A	ISS
GO:0070838	GO-bp	Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0004740	GO-mf	Annotation by Michelle Graham. GO Molecular Function: pyruvate dehydrogenase (acetyl-transferring) kinase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0009927	GO-mf	Annotation by Michelle Graham. GO Molecular Function: histidine phosphotransfer kinase activity	SoyBase	N/A	ISS
GO:0042803	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity	SoyBase	N/A	ISS
PTHR11947	Panther	PYRUVATE DEHYDROGENASE KINASE	JGI		ISS
PTHR11947:SF3	Panther	PYRUVATE DEHYDROGENASE KINASE	JGI		ISS
PF02518	PFAM	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	JGI		ISS
UniRef100_A0MP01	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Mitochondrial pyruvate dehydrogenase E1alpha-kinase 3 n=1 Tax=Glycine max RepID=A0MP01_SOYBN	SoyBase	E_val: 1.00E-93	ISS
UniRef100_I1MRY2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MRY2_SOYBN	SoyBase	E_val: 2.00E-95	ISS

Expression Patterns of Glyma14g15320

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g15320 not represented in the dataset	Glyma14g15320 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g15320 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g127500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g15320

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g15320

Limit To All Plant Sequences

>Glyma14g15320.1   sequence type=CDS   gene model=Glyma14g15320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTACGAATTAGGGCCATTTTTGTGCTTGAGAATGTAGGGGCCTGGGTTATGGTCCAAGATTGGTTCGGTCTTGGAATTCGTATGCTCATCTGGCAGCATGTTGAGTTGTACAATCCCAATCCTCCTCCCAATTGTGTAGGTTATATACATACAAATATGTCTCCTATGAATGTGGCAAGGAATGCTATGCCCCAGATGTTCGCATTTACGGGGATCCTGATTTTACTTTTCCCTCACTTGCATCTTATGGTATTTGAGTTGGTTAAGAACTCGCTGCGTGCTGTCCAAGAGCGTTTTATGGACTCTGACGAAGTTGCTCCTCCCATTAGAATAATAATAGCAGATGGAATAGAGGATGTTACCATAAAGGTCTCAGATGAGGGAGGTGGAATACCAAGGAGTGGTCTTCCAAGAATTTTTACATATCTCTACAGTACAGCTGGAATCTCATTGTCAGTCGAACATGAACTTTCTGATATTGGAACAATGGAAAATGTAACAATGGCTGGATATGGTTATGGACTTCCTATTTGCCGCTTGTATGCTAGGTATTTTGGTGGTGATCTTCAAGTAATCTCTATGGAATGA

Predicted protein sequences of Glyma14g15320

Limit To All Plant Sequences

>Glyma14g15320.1   sequence type=predicted peptide   gene model=Glyma14g15320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LRIRAIFVLENVGAWVMVQDWFGLGIRMLIWQHVELYNPNPPPNCVGYIHTNMSPMNVARNAMPQMFAFTGILILLFPHLHLMVFELVKNSLRAVQERFMDSDEVAPPIRIIIADGIEDVTIKVSDEGGGIPRSGLPRIFTYLYSTAGISLSVEHELSDIGTMENVTMAGYGYGLPICRLYARYFGGDLQVISME*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain