SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g15093

Feature Type:gene_model
Chromosome:Gm14
Start:15813210
stop:15816459
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g15093
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G05680AT Annotation by Michelle Graham. TAIR10: embryo defective 2016 | chr3:1660802-1672015 REVERSE LENGTH=2138 SoyBaseE_val: 4.00E-29ISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_F4J8G7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Embryo defective 2016 protein n=1 Tax=Arabidopsis thaliana RepID=F4J8G7_ARATH SoyBaseE_val: 2.00E-26ISS
UniRef100_UPI000233D269UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233D269 related cluster n=1 Tax=unknown RepID=UPI000233D269 SoyBaseE_val: 2.00E-40ISS

Expression Patterns of Glyma14g15093
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g15093 not represented in the dataset
Glyma14g15093 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g15093 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma14g15093
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g15093
>Glyma14g15093.1   sequence type=CDS   gene model=Glyma14g15093   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTTGTAGATCGGATTGTGGGCGCCAGGCATTATTGGCTTTAGGGAATTTTCCTGAGACTGTTGCTGCGACTCTCTATGATGAAGGCGCTGTAATAGTTATTTATGCCATTTTGGTCAACTGCAGATTCATGCTTGAGAGGTCCTCAAACAATTATGATTACCTTGTAGATGAGGGTACAAAATGCAATGCTACTTCTGATTTACTACTGGAACGTAATTGTGAGCTGAACATAGTTGATCTTTTGGTTCCTTCTCTGGTGCTATTGATTACACTACTTAAGAAATTACAAGTGTCTAATTTGGCAAAACACCATGAAGAGTTAAAAGATATGTCTAGCTTTCTACATCGGTTCAGGCCAAAACCGATGTAG
Predicted protein sequences of Glyma14g15093
>Glyma14g15093.1   sequence type=predicted peptide   gene model=Glyma14g15093   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MICRSDCGRQALLALGNFPETVAATLYDEGAVIVIYAILVNCRFMLERSSNNYDYLVDEGTKCNATSDLLLERNCELNIVDLLVPSLVLLITLLKKLQVSNLAKHHEELKDMSSFLHRFRPKPM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo