Glyma14g13080 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g13080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g13080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g13080

Feature Type:	gene_model
Chromosome:	Gm14
Start:	12213673
stop:	12214522
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g13080

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G53520	AT	Annotation by Michelle Graham. TAIR10: UDP-glucuronic acid decarboxylase 1 \| chr3:19841635-19843520 FORWARD LENGTH=354	SoyBase	E_val: 2.00E-51	ISS
GO:0009225	GO-bp	Annotation by Michelle Graham. GO Biological Process: nucleotide-sugar metabolic process	SoyBase	N/A	ISS
GO:0042732	GO-bp	Annotation by Michelle Graham. GO Biological Process: D-xylose metabolic process	SoyBase	N/A	ISS
GO:0044237	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular metabolic process	SoyBase	N/A	ISS
GO:0005768	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endosome	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005802	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0048040	GO-mf	Annotation by Michelle Graham. GO Molecular Function: UDP-glucuronate decarboxylase activity	SoyBase	N/A	ISS
GO:0050662	GO-mf	Annotation by Michelle Graham. GO Molecular Function: coenzyme binding	SoyBase	N/A	ISS
PTHR10366	Panther	NAD DEPENDENT EPIMERASE/DEHYDRATASE	JGI		ISS
PTHR10366:SF35	Panther	gb def: udp-glucose 4-epimerase [bacillus halodurans]	JGI		ISS
UniRef100_B3H4I6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: UDP-glucuronic acid decarboxylase 1 n=1 Tax=Arabidopsis thaliana RepID=B3H4I6_ARATH	SoyBase	E_val: 1.00E-48	ISS
UniRef100_I1L8M8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L8M8_SOYBN	SoyBase	E_val: 5.00E-50	ISS

Expression Patterns of Glyma14g13080

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g13080 not represented in the dataset	Glyma14g13080 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g13080 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma14g13080

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g13080

Limit To All Plant Sequences

>Glyma14g13080.1   sequence type=CDS   gene model=Glyma14g13080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CGAGTCCGTTGTTCATCCTCGTCTGCATCCTCATCGACTCCACCTTCTTCATCATCCAGCCCACTCTCTCCCGCATGGGCCCATCCGAGGCGGCCCACACATTCCTCCCTCGAACCGGGCTTGCCCGCTTCAGCGGCACAAGGCCTCGCACGGGCCGTATTCTGGTCAGGATCAGCGGCAGGAGGCAGCGAATCATCGTCACCGACGACACGAGGCTTCGTGGGGAGCCACCTCGTCGACAAACTCATCACTCGCGGTGACGACATCATCGTGATCGAAAATTTCTTCACAGGAAGAAAAGAGAACCTGGTGCATCTGTTCGGGACCCTAGTTCGAGCTCAGTCCCACGTCATCAAGACGAATGTGATGGACACGCTTAACATGCTTGGCCTTGCGAAAAGAATTGGGGCTAGGTTTCTGCTTACTAGTACTAAGACTTACTGGGGAAATGTGAATCCAATTGGTGAGAGGAGTTGTTACGATGAAGGGAAAAGGATTGTGGAGACGTTGGCCATGGATTATCATCGGGGTGCTGGTGTTGAG

Predicted protein sequences of Glyma14g13080

Limit To All Plant Sequences

>Glyma14g13080.1   sequence type=predicted peptide   gene model=Glyma14g13080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RVRCSSSSASSSTPPSSSSSPLSPAWAHPRRPTHSSLEPGLPASAAQGLARAVFWSGSAAGGSESSSPTTRGFVGSHLVDKLITRGDDIIVIENFFTGRKENLVHLFGTLVRAQSHVIKTNVMDTLNMLGLAKRIGARFLLTSTKTYWGNVNPIGERSCYDEGKRIVETLAMDYHRGAGVE

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain