Glyma14g12880 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g12880): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g12880): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g12880

Feature Type:	gene_model
Chromosome:	Gm14
Start:	11846472
stop:	11848612
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g12880

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G46210	AT	Annotation by Michelle Graham. TAIR10: Ribosomal protein S5 domain 2-like superfamily protein \| chr3:16976960-16978489 REVERSE LENGTH=239	SoyBase	E_val: 2.00E-104	ISS
GO:0000398	GO-bp	Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome	SoyBase	N/A	ISS
GO:0001510	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA methylation	SoyBase	N/A	ISS
GO:0006396	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA processing	SoyBase	N/A	ISS
GO:0006626	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion	SoyBase	N/A	ISS
GO:0051604	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein maturation	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0000175	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 3'-5'-exoribonuclease activity	SoyBase	N/A	ISS
GO:0003723	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA binding	SoyBase	N/A	ISS
KOG1069	KOG	Exosomal 3'-5' exoribonuclease complex, subunit Rrp46	JGI		ISS
PTHR11953	Panther	RIBONUCLEASE PH RELATED	JGI		ISS
PF01138	PFAM	3' exoribonuclease family, domain 1	JGI		ISS
UniRef100_G7L3K7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Exosome complex exonuclease RRP46 n=1 Tax=Medicago truncatula RepID=G7L3K7_MEDTR	SoyBase	E_val: 2.00E-113	ISS
UniRef100_UPI000233BB46	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233BB46 related cluster n=1 Tax=unknown RepID=UPI000233BB46	SoyBase	E_val: 2.00E-149	ISS

Expression Patterns of Glyma14g12880

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g12880 not represented in the dataset	Glyma14g12880 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g12880 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g108100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g12880

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g12880

Limit To All Plant Sequences

>Glyma14g12880.1   sequence type=CDS   gene model=Glyma14g12880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGACTGACAGACCTGACAGCCAGACTCCCAATCAACTGAGACCCCTGGCCTGCTCCTGCTCCTGCTCCATCCTACATCGATCCCATGGCTCGGCCAGTTGGGCTCAACGTGAAACTAAAGTGCTTGCTGCAGTTTACGGGCCCAAAGCTGGAACCAAGAAGAACGAAAACCCCAAAAAAGCATCCATTAAAGTTATTTGGAAACCGAAGACTGGACAAATTGGAAAAGTGGAGAAGGAGTATGAGATGATATTGAAAAGAACTTTGGAAAGCATCTGCATTCGAACAATATATCCCAACACCACCACTTTGGTTATAGTCCAGATTGTCCACGATGATGGTGTTCTTCTTCCATGTGCAATAAATGCAGCATGCGTTGCACTTGTGGATGCGAGAATTCCCCTAAAACATCTTGTTGTAGCAATATGTTGTTCTATAACAGACAGTGGTTGTATTATATTGGACCCAACCAAAGATCAAGAGGAGAAAATGAAAGCATTCATCAATTTAGTTTTTCCAAATACAATTGTTTCTGTCCTCCCAGAGGGATCACTACAGGAGGGTAGTGAGACTATGGCACATGGAATCATGACATCTATTACACAGGGTGCTATGTCA

Predicted protein sequences of Glyma14g12880

Limit To All Plant Sequences

>Glyma14g12880.1   sequence type=predicted peptide   gene model=Glyma14g12880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METDRPDSQTPNQLRPLACSCSCSILHRSHGSASWAQRETKVLAAVYGPKAGTKKNENPKKASIKVIWKPKTGQIGKVEKEYEMILKRTLESICIRTIYPNTTTLVIVQIVHDDGVLLPCAINAACVALVDARIPLKHLVVAICCSITDSGCIILDPTKDQEEKMKAFINLVFPNTIVSVLPEGSLQEGSETMAHGIMTSITQGAMS

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain