SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g12210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g12210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g12210

Feature Type:gene_model
Chromosome:Gm14
Start:10954947
stop:10958436
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G02570AT Annotation by Michelle Graham. TAIR10: cullin 1 | chr4:1129315-1133435 FORWARD LENGTH=738 SoyBaseE_val: 3.00E-164ISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0007049GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009880GO-bp Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification SoyBaseN/AISS
GO:0010072GO-bp Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification SoyBaseN/AISS
GO:0010087GO-bp Annotation by Michelle Graham. GO Biological Process: phloem or xylem histogenesis SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010265GO-bp Annotation by Michelle Graham. GO Biological Process: SCF complex assembly SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0042752GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of circadian rhythm SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0048316GO-bp Annotation by Michelle Graham. GO Biological Process: seed development SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0000151GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ubiquitin ligase complex SoyBaseN/AISS
GO:0000794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: condensed nuclear chromosome SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005819GO-cc Annotation by Michelle Graham. GO Cellular Compartment: spindle SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009524GO-cc Annotation by Michelle Graham. GO Cellular Compartment: phragmoplast SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0031625GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin protein ligase binding SoyBaseN/AISS
PTHR11932Panther CULLIN JGI ISS
PTHR11932:SF21Panther CULLIN-RELATED JGI ISS
PF00888PFAM Cullin family JGI ISS
UniRef100_B9RT30UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cullin-1, putative n=1 Tax=Ricinus communis RepID=B9RT30_RICCO SoyBaseE_val: 1.00E-180ISS
UniRef100_I1MRG9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MRG9_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g12210 not represented in the dataset

Glyma14g12210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma14g12210.1   sequence type=CDS   gene model=Glyma14g12210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GATGGGCAAACCATAAAATTATGGTTTGGAGGCTTTCTCGATTCTTTCACTATTTGGATCGACTTTATTGCTTGGAGGTCACTTCCGCCCCTTAATGAAGTTGGCATAATTTGCTTCCATGATTTGAATGTATTAGACATATTTGTTGAAATTGGAATGGGGCAAATGGATCACTATGAGAATGATTTTGAAGCTGCCATGCTCAAAGACACTTCTTCTTATTATTCTCGAAAGGCTTCAAATTGGATCCTAGAAGATTCTTGTCCTGATTATATGCTGAAGGAGTGCTTAAAATGGGAGAAAGATAGGGTTGCTCATTACTTGCACTCTAGTAGGGAGCCAAAGTTATTAGAGAAAGTTCAACACGAGTTGTTATCTGTGTATACAAATCAACTCCTTAAGAAAGAGCACTCTGGATATCATGCTTTACTTAGAGATGATAAATTCAACACGAGTTGTTATCTGTGTATACAAATCAACTCCTTAAGAAAGAGCACTCTGGATATCATGCCTTACTTAGAGATGATAAAGTTGAAGACTTGTCAAGAATGTTCAGGCTATTCTAAAATACCTCGAGGCTTAGATCCTATTTCCAATATATTTAAACAAGTTGTGTCAATATTGGGCTCTCATGTTCTGCTTGCTTTCTTGCTCACTTGCTTATCTTTCTCTCTTCCCTTTCCTCAACATGTTACCATTGATGGTATGGCTTTGGTGAAGCATGCTGAAGATGCAGCTAGCAACAAAAAGGTTTTTTTTCAGAAGGTAATTGAGTTGTTTGACAAGTATGTGACATATGTGAATGATTATTTCCATAATCATACTCTTTTCCATAAGGTCTTTTGCAACAAAGGTGTTGCTGGAAGTTCAAGCGCAGAACTGCTTGCCTCCTTTTGTGATAACATTCTTAAAAAAGGAGGAAGTGAAAAATTAAGTGATGAAGCAATTGAAGAAACTCTTGAAAAGGTGGTCAAGTTGCTTGCCTATATTAGTGGCAAAGACTTGTTTGCTAAATTCTATAGGAAGAAGCTTGCTCGAAGGCTTCTCTTTGACAAGAGTGCCAATGATGATCATGAGCGAAGTATTTTGACAAAATTGAAGCAACAATGTGGTGGACAGTTTACCTCAAAGATGGAAGGAATGGTTACAGATTTGACACTAGCAAAGGAGAATCAAACTAGCTTTGAGGAGTATTTAAGCAATAATCCCAATGTAGACCCAAGCATGGACTTGACA

>Glyma14g12210.1   sequence type=predicted peptide   gene model=Glyma14g12210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
DGQTIKLWFGGFLDSFTIWIDFIAWRSLPPLNEVGIICFHDLNVLDIFVEIGMGQMDHYENDFEAAMLKDTSSYYSRKASNWILEDSCPDYMLKECLKWEKDRVAHYLHSSREPKLLEKVQHELLSVYTNQLLKKEHSGYHALLRDDKFNTSCYLCIQINSLRKSTLDIMPYLEMIKLKTCQECSGYSKIPRGLDPISNIFKQVVSILGSHVLLAFLLTCLSFSLPFPQHVTIDGMALVKHAEDAASNKKVFFQKVIELFDKYVTYVNDYFHNHTLFHKVFCNKGVAGSSSAELLASFCDNILKKGGSEKLSDEAIEETLEKVVKLLAYISGKDLFAKFYRKKLARRLLFDKSANDDHERSILTKLKQQCGGQFTSKMEGMVTDLTLAKENQTSFEEYLSNNPNVDPSMDLT







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo