Glyma14g11660 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g11660

Feature Type:	gene_model
Chromosome:	Gm14
Start:	10211074
stop:	10215248
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g11660

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G10810	AT	Annotation by Michelle Graham. TAIR10: enhancer of rudimentary protein, putative \| chr5:3418897-3420556 REVERSE LENGTH=109	SoyBase	E_val: 1.00E-54	ISS
GO:0007049	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell cycle	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
KOG1766	KOG	Enhancer of rudimentary	JGI		ISS
PTHR12373	Panther	ENHANCER OF RUDIMENTARY ERH	JGI		ISS
PF01133	PFAM	Enhancer of rudimentary	JGI		ISS
UniRef100_C6TKU9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Enhancer of rudimentary homolog n=2 Tax=Glycine max RepID=C6TKU9_SOYBN	SoyBase	E_val: 1.00E-69	ISS
UniRef100_C6TKU9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Enhancer of rudimentary homolog n=2 Tax=Glycine max RepID=C6TKU9_SOYBN	SoyBase	E_val: 1.00E-69	ISS

Expression Patterns of Glyma14g11660

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g11660

Paralog	Evidence	Comments
Glyma17g34140	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g11660 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g101000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g11660

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g11660

Limit To All Plant Sequences

>Glyma14g11660.1   sequence type=CDS   gene model=Glyma14g11660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTAATCGGCACACGATTATTCTAATGCAGACCTCGCAGAACAGAGCAACTAGGACGTTCATGGATTATGAATCCATAACTCAGGCCATGGATGGCATATGTGCACTGTATGAAAGGAAACTGAAGGAGTTGAATCCGGCTATCAGAAATCTCTCTTATGACATTACTGATCTCTACAACTTCATAGATGGTCTTGCGGACATGAGTGCCCTAGTGTATGATAGTTCAATTCACGCTTACTTGCCGCATGATCGACTGTGGATCAAGCAACGAACATTCCAACATTTGAAGAAATTAGCACACTGA

Predicted protein sequences of Glyma14g11660

Limit To All Plant Sequences

>Glyma14g11660.1   sequence type=predicted peptide   gene model=Glyma14g11660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANRHTIILMQTSQNRATRTFMDYESITQAMDGICALYERKLKELNPAIRNLSYDITDLYNFIDGLADMSALVYDSSIHAYLPHDRLWIKQRTFQHLKKLAH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain