|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G30330 | AT | Annotation by Michelle Graham. TAIR10: Small nuclear ribonucleoprotein family protein | chr4:14836773-14837919 REVERSE LENGTH=88 | SoyBase | E_val: 2.00E-14 | ISS |
| GO:0016925 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein sumoylation | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0005732 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: small nucleolar ribonucleoprotein complex | SoyBase | N/A | ISS |
| GO:0003674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: molecular function | SoyBase | N/A | ISS |
| PTHR11193 | Panther | SNRNP SM FAMILY MEMBER | JGI | ISS | |
| PF01423 | PFAM | LSM domain | JGI | ISS | |
| UniRef100_B9S9Y9 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Small nuclear ribonucleoprotein E, putative n=1 Tax=Ricinus communis RepID=B9S9Y9_RICCO | SoyBase | E_val: 1.00E-14 | ISS |
| UniRef100_C6SYH7 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SYH7_SOYBN | SoyBase | E_val: 9.00E-15 | ISS |
|
Glyma14g11580 not represented in the dataset |
Glyma14g11580 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma14g11580.1 sequence type=CDS gene model=Glyma14g11580 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGAATTTGGTTCTTGATGATGCTGAAGAAGTGAACATCAAGAAGAAGAGCAGAAAAACATTAGGGAGGATCCTTCTTAAACGAGATAACATAACTTTAATGATGAACACATAA
>Glyma14g11580.1 sequence type=predicted peptide gene model=Glyma14g11580 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MNLVLDDAEEVNIKKKSRKTLGRILLKRDNITLMMNT*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||