SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g11440

Feature Type:gene_model
Chromosome:Gm14
Start:9976838
stop:9978258
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g11440
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G26170AT Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 50 | chr5:9147176-9148128 REVERSE LENGTH=173 SoyBaseE_val: 5.00E-38ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
PF03106PFAM WRKY DNA -binding domain JGI ISS
UniRef100_G7J8C4UniRef Annotation by Michelle Graham. Most informative UniRef hit: WRKY transcription factor n=1 Tax=Medicago truncatula RepID=G7J8C4_MEDTR SoyBaseE_val: 1.00E-44ISS
UniRef100_I1M967UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M967_SOYBN SoyBaseE_val: 2.00E-70ISS

Proteins Associated with Glyma14g11440
LocusGene SymbolProtein Name
WRKY142 WRKY Transcription Factor
WRKY132 WRKY Transcripiton Factor

Expression Patterns of Glyma14g11440
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g11440
ParalogEvidenceComments
Glyma17g34210 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g11440 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma14g11440
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g11440
>Glyma14g11440.2   sequence type=CDS   gene model=Glyma14g11440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAGACAAAAATCCAAAACCACCACCACCAGACAGACCTGACATACTTAAATTCGATGACAATCAATGGATGCATGATGATCTTGAGTCGGTTGCTTCTGAGAATGTCTTAAACCAAGTTCATCAGGCCAGTAATTTAGGTGAGTTTGGAGGAGGAAGCAGTCACTTTGAAGGGTCTTCTAGCAAGAGAGTTGCATTCAAAACAATGTCAGAGATTGAAGTACTTGACGATGGCTACAGATGGAGGAAGTACGGAAAGAAAATGGTGAAAAAATGCCCAAATCCAAGGAATAACTACAGGTGTTCAGTGGATGGATGCACTGTGAAAAAGAGAGTGGAGAGAGACAAGGATGACCCAAGGTATGTAATAACAACCTACGAAGGCAACCACACTCATCCAACTTCTTCCTAG
Predicted protein sequences of Glyma14g11440
>Glyma14g11440.2   sequence type=predicted peptide   gene model=Glyma14g11440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTDKNPKPPPPDRPDILKFDDNQWMHDDLESVASENVLNQVHQASNLGEFGGGSSHFEGSSSKRVAFKTMSEIEVLDDGYRWRKYGKKMVKKCPNPRNNYRCSVDGCTVKKRVERDKDDPRYVITTYEGNHTHPTSS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo