Glyma14g11185 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g11185): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g11185): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g11185

Feature Type:	gene_model
Chromosome:	Gm14
Start:	9596408
stop:	9603275
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g11185

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G21200	AT	Annotation by Michelle Graham. TAIR10: proton gradient regulation 7 \| chr3:7436091-7437845 FORWARD LENGTH=317	SoyBase	E_val: 4.00E-41	ISS
GO:0009767	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport chain	SoyBase	N/A	ISS
GO:0009791	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-embryonic development	SoyBase	N/A	ISS
GO:0033014	GO-bp	Annotation by Michelle Graham. GO Biological Process: tetrapyrrole biosynthetic process	SoyBase	N/A	ISS
GO:0070455	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of heme biosynthetic process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009534	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0043495	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein anchor	SoyBase	N/A	ISS
UniRef100_C6SX06	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6SX06_SOYBN	SoyBase	E_val: 1.00E-114	ISS
UniRef100_Q9LU39	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Proton gradient regulation 7 n=1 Tax=Arabidopsis thaliana RepID=Q9LU39_ARATH	SoyBase	E_val: 2.00E-38	ISS

Expression Patterns of Glyma14g11185

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g11185 not represented in the dataset	Glyma14g11185 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g11185 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g098400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g11185

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g11185

Limit To All Plant Sequences

>Glyma14g11185.1   sequence type=CDS   gene model=Glyma14g11185   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCACTCCCTTGTTCTGCTTCAGTTCCACTGACAACACTAACATCCCCTCTTCTCTTCATGTTCAGTTTGAACAATTTGGACTGCGCACTCCTCAGTCCAAAGCGTCTTGTTTCTGTGTGGAGGAAAAGGTTTGGAGAAGAAGTTGATCAAGATTTTATTTACATTATTGCCGTGGATCGGATACTCCAATTGGAAGACATTCAGGAGGATGGCATATGGGTCACCTCTTCAGATTACAAAAATGCTCAACCCGATCCTCTTCGGGACTCTGCACACAACTTAGTCACTGAAATCAACACCAACAATATGGAAGACATTACTCGCTTTTGCAATGTCTACGTTGATTTGGATTTCCTGGTATTGACTGTGAGCCTAATCTATCGAATCAGCACAATGTACTGGGATGACAAGTATGGAACCCAAAGTGTGTCCAATGAGGTAGTTAGTGAAATGAGAGAATTCTCAGCAAGGACAATCAGAATTTGA

Predicted protein sequences of Glyma14g11185

Limit To All Plant Sequences

>Glyma14g11185.1   sequence type=predicted peptide   gene model=Glyma14g11185   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALPCSASVPLTTLTSPLLFMFSLNNLDCALLSPKRLVSVWRKRFGEEVDQDFIYIIAVDRILQLEDIQEDGIWVTSSDYKNAQPDPLRDSAHNLVTEINTNNMEDITRFCNVYVDLDFLVLTVSLIYRISTMYWDDKYGTQSVSNEVVSEMREFSARTIRI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain