Glyma14g11040 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g11040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g11040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g11040

Feature Type:	gene_model
Chromosome:	Gm14
Start:	9330092
stop:	9335778
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g11040

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G26170	AT	Annotation by Michelle Graham. TAIR10: cytochrome P450, family 711, subfamily A, polypeptide 1 \| chr2:11141703-11143270 FORWARD LENGTH=439	SoyBase	E_val: 0	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009805	GO-bp	Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process	SoyBase	N/A	ISS
GO:0009926	GO-bp	Annotation by Michelle Graham. GO Biological Process: auxin polar transport	SoyBase	N/A	ISS
GO:0009934	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of meristem structural organization	SoyBase	N/A	ISS
GO:0009963	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0010223	GO-bp	Annotation by Michelle Graham. GO Biological Process: secondary shoot formation	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0016117	GO-bp	Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005506	GO-mf	Annotation by Michelle Graham. GO Molecular Function: iron ion binding	SoyBase	N/A	ISS
GO:0009055	GO-mf	Annotation by Michelle Graham. GO Molecular Function: electron carrier activity	SoyBase	N/A	ISS
GO:0016705	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	SoyBase	N/A	ISS
GO:0019825	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxygen binding	SoyBase	N/A	ISS
GO:0020037	GO-mf	Annotation by Michelle Graham. GO Molecular Function: heme binding	SoyBase	N/A	ISS
KOG0158	KOG	Cytochrome P450 CYP3/CYP5/CYP6/CYP9 subfamilies	JGI		ISS
PTHR24301	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24301:SF126	Panther		JGI		ISS
PF00067	PFAM	Cytochrome P450	JGI		ISS
UniRef100_G7I9V8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 n=1 Tax=Medicago truncatula RepID=G7I9V8_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233B9B9	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B9B9 related cluster n=1 Tax=unknown RepID=UPI000233B9B9	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma14g11040

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g11040 not represented in the dataset	Glyma14g11040 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g11040

Paralog	Evidence	Comments
Glyma17g34530	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g11040 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g096900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g11040

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g11040

Limit To All Plant Sequences

>Glyma14g11040.1   sequence type=CDS   gene model=Glyma14g11040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGACAACCACTAATCTTGGTAGCAGATCCAGAGCTTTGTAAAAAAGTGGGTATCAAACAATTCAAAGACATTCCAAACAGAAGCATTCCCTCTCCTATTTCTGCTTCTCCTCTTCACCAAAAAGGTCTCTTCTTTACCAGGGACTCACGTTGGTCAGCCATGCGAAACACGATCTTGTCAGTGTACCAGCCATCACACTTGGCTAGCTTAGTGCCAATGATGCAATCATTCATAGAATCCGCAACACAAAATCTTGATACCCCAAATGAGGACATAATCTTTTCCAATCTTTCCCTAAGGCTAGCAACTGATGTGATTGGAGAGGCAGCATTTGGTGTCAACTTTGGCCTCTCTAAGCCCATTTCAGTTTGTGAATCAATCAAGAGTGTTAGTGTTAACAATGTGAGAAATGATGATAATGATAATGGTGATGATGAAGTATCAGATTTCATCAATCAACACATTTACTCCACAGCACAACTTAAGATGGACTTGTCTGGTTCATTCTCCATCATACTTGGTCTACTTGCACCAATACTTCAGGAGCCATTTAGGCAGATTCTGAAGAGAATACCAGGCACAATGGACAGGAAAATAGAGAGTACTAATGAGAAACTTAGTGGTCGTCTTGATGAGATTGTCAAGAGGAGAATGGAAAACAAGAATAGAACTTCAAAGAATTTCTTGTCACTCATTTTGAATGCAAGAGAATCAAAGAAAGTATCTGAAAATGTCTTTTCACCTGACTACGTTAGTGCTGTTACTTATGAGCACTTACTTGCTGGGTCAGCTACTACAGCCTTTACCTTGTCATCCATTGTCTACTTGGTTGCTGGACACATAGAAGTTGAGAAAAAGTTGCTTCAAGAGATTGATGGATTTGGTACACCTGATAGGATTCCCATAGCTCAAGATCTTCATGACAGTTTTCCTTATCTTGATCAGGTGATTAAAGAGGCCATGAGGTTTTACACTGTCTCCCCATTGGTTGCAAGAGAAGCATCAAATGAGGTGGAGATAGGAGGTTATCTTCTTCCAAAGGGGACGTGGGTATGGTTAGCTCTTGGAGTTCTAGCAAAAGATCCAAGAAATTTTCCAGAGCCTGAGAAGTTTAAACCAGAGAGGTTTGACCCCAAATGTGAAGAAATGAAAAGAAGGCATCCTTATGCATTCATACCATTTGGAATTGGTCCCCGGGCATGTATTGGTCAGAAATTTTCCCTACAAGAGATCAAACTTTCTCTGATTCATTTGTACCGAAAATATGTTTTTCGTCATTCACTTGACATGGAAAACCCTGTAGAAATGGAATATGGTATGGTTCTCAACTTCAAGCATGGTCTCAAGCTTAGAGTCATAAGAAGAACGTAA

Predicted protein sequences of Glyma14g11040

Limit To All Plant Sequences

>Glyma14g11040.1   sequence type=predicted peptide   gene model=Glyma14g11040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRQPLILVADPELCKKVGIKQFKDIPNRSIPSPISASPLHQKGLFFTRDSRWSAMRNTILSVYQPSHLASLVPMMQSFIESATQNLDTPNEDIIFSNLSLRLATDVIGEAAFGVNFGLSKPISVCESIKSVSVNNVRNDDNDNGDDEVSDFINQHIYSTAQLKMDLSGSFSIILGLLAPILQEPFRQILKRIPGTMDRKIESTNEKLSGRLDEIVKRRMENKNRTSKNFLSLILNARESKKVSENVFSPDYVSAVTYEHLLAGSATTAFTLSSIVYLVAGHIEVEKKLLQEIDGFGTPDRIPIAQDLHDSFPYLDQVIKEAMRFYTVSPLVAREASNEVEIGGYLLPKGTWVWLALGVLAKDPRNFPEPEKFKPERFDPKCEEMKRRHPYAFIPFGIGPRACIGQKFSLQEIKLSLIHLYRKYVFRHSLDMENPVEMEYGMVLNFKHGLKLRVIRRT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain