Glyma14g10680 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g10680): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g10680): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g10680

Feature Type:	gene_model
Chromosome:	Gm14
Start:	8880228
stop:	8882601
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g10680

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G11770	AT	Annotation by Michelle Graham. TAIR10: NADH-ubiquinone oxidoreductase 20 kDa subunit, mitochondrial \| chr5:3791148-3792929 REVERSE LENGTH=218	SoyBase	E_val: 2.00E-116	ISS
GO:0006120	GO-bp	Annotation by Michelle Graham. GO Biological Process: mitochondrial electron transport, NADH to ubiquinone	SoyBase	N/A	ISS
GO:0006486	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein glycosylation	SoyBase	N/A	ISS
GO:0006511	GO-bp	Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process	SoyBase	N/A	ISS
GO:0009853	GO-bp	Annotation by Michelle Graham. GO Biological Process: photorespiration	SoyBase	N/A	ISS
GO:0051788	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to misfolded protein	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0080129	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005747	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial respiratory chain complex I	SoyBase	N/A	ISS
GO:0008137	GO-mf	Annotation by Michelle Graham. GO Molecular Function: NADH dehydrogenase (ubiquinone) activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
GO:0016651	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on NAD(P)H	SoyBase	N/A	ISS
GO:0048038	GO-mf	Annotation by Michelle Graham. GO Molecular Function: quinone binding	SoyBase	N/A	ISS
GO:0051539	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 4 iron, 4 sulfur cluster binding	SoyBase	N/A	ISS
KOG1687	KOG	NADH-ubiquinone oxidoreductase, NUFS7/PSST/20 kDa subunit	JGI		ISS
PTHR11995	Panther	NADH DEHYDROGENASE	JGI		ISS
PF01058	PFAM	NADH ubiquinone oxidoreductase, 20 Kd subunit	JGI		ISS
UniRef100_I1M904	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M904_SOYBN	SoyBase	E_val: 2.00E-151	ISS
UniRef100_P42027	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial n=1 Tax=Brassica oleracea RepID=NDUS7_BRAOL	SoyBase	E_val: 2.00E-114	ISS

Expression Patterns of Glyma14g10680

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g10680 not represented in the dataset	Glyma14g10680 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g10680 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g093300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g10680

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g10680

Limit To All Plant Sequences

>Glyma14g10680.1   sequence type=CDS   gene model=Glyma14g10680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCTCGTCACCCGAATCGGACTCACGTGGCGCCTCCCTCAGCGGCTAGTTTCCGCGTCTCTCCACAGCAATTCCACTGGCACCACCGCTCCCACTAGTTACTGTGCGTTGCCGCAGCCAACAGCGAATTCTTCCCCCGTGGGCCTCTCGAAGCCGGCGGAATTCGTGATCTCGAAGGTGGACTCCCTCTTGAACTGGGCCCGCACAGGGTCCATCTGGCCCATGACGTTTGGGCTGGCCTGTTGCGCTGTGGAGATGATGCACACGGGCGGGGCCCGTTATGATCTAGACCGCTTTGGAATCATTTTTAGGCCTAGCCCGCGTCAATCCGATTGCATGATCGTTGCTGGCACACTCACCAACAAGATGGCCCCTGCTCTTCGCAAGGTTTATGATCAAATGCCTGAGCCAAGGTGGGTGATCTCAATGGGAAGCTGTGCTAATGGAGGTGGATATTACCACTATTCATACGCTGTTGTTAGAGGATGTGACAGAATAGTTCCTGTTGACATATACGTTCCAGGTTGTCCTCCAACTGCAGAGGCTTTGCTATATGGCCTCCTCCAGCTGCAGAAGAAGATCAATAGGCGCAAGGACTTCCTCTGGTGGTGGACCAGGTGA

Predicted protein sequences of Glyma14g10680

Limit To All Plant Sequences

>Glyma14g10680.1   sequence type=predicted peptide   gene model=Glyma14g10680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALVTRIGLTWRLPQRLVSASLHSNSTGTTAPTSYCALPQPTANSSPVGLSKPAEFVISKVDSLLNWARTGSIWPMTFGLACCAVEMMHTGGARYDLDRFGIIFRPSPRQSDCMIVAGTLTNKMAPALRKVYDQMPEPRWVISMGSCANGGGYYHYSYAVVRGCDRIVPVDIYVPGCPPTAEALLYGLLQLQKKINRRKDFLWWWTR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain