SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g09741

Feature Type:gene_model
Chromosome:Gm14
Start:7791776
stop:7792536
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g09741
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48470AT Annotation by Michelle Graham. TAIR10: embryo defective 2423 | chr3:17951689-17956754 FORWARD LENGTH=1027 SoyBaseE_val: 5.00E-32ISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PTHR15830Panther FAMILY NOT NAMED JGI ISS
PTHR15830:SF5Panther gb def: Hypothetical protein T29H11 10 JGI ISS
PF10193PFAM Telomere length regulation protein JGI ISS
UniRef100_F4JF17UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein embryo defective 2423 n=1 Tax=Arabidopsis thaliana RepID=F4JF17_ARATH SoyBaseE_val: 2.00E-29ISS
UniRef100_I1KC73UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KC73_SOYBN SoyBaseE_val: 2.00E-37ISS

Expression Patterns of Glyma14g09741
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g09741 not represented in the dataset
Glyma14g09741 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g09741 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g088000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g09741
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g09741
>Glyma14g09741.1   sequence type=CDS   gene model=Glyma14g09741   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACCAGAACTCTTGTTCAGGTTCGGTGCTCTGATATAGCTTTAGAAGGTGCAGAAGAATCAACTGAAGACAAAAGACAAAGATCATTAGTTGCCTTAGTAGTCACCTGCCCATTTGAATCACTTGAGTCACTAAACAACCTTTTGTATTCACCTAATGTAGATATCAGTCAGCGCATTATGATACTAGATGTCATGACAGAAGCAGAGCTCAGGAGCTTGCAGAATAAAAAATTATGA
Predicted protein sequences of Glyma14g09741
>Glyma14g09741.1   sequence type=predicted peptide   gene model=Glyma14g09741   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTRTLVQVRCSDIALEGAEESTEDKRQRSLVALVVTCPFESLESLNNLLYSPNVDISQRIMILDVMTEAELRSLQNKKL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo