Glyma14g09420 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g09420): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g09420): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g09420

Feature Type:	gene_model
Chromosome:	Gm14
Start:	7482139
stop:	7484017
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g09420

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G43060	AT	Annotation by Michelle Graham. TAIR10: Granulin repeat cysteine protease family protein \| chr5:17269784-17272117 REVERSE LENGTH=463	SoyBase	E_val: 7.00E-79	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0052541	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall cellulose metabolic process	SoyBase	N/A	ISS
GO:0052546	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall pectin metabolic process	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0008234	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cysteine-type peptidase activity	SoyBase	N/A	ISS
PTHR12411	Panther	CYSTEINE PROTEASE FAMILY C1-RELATED	JGI		ISS
PTHR12411:SF44	Panther	CATHEPSIN L-RELATED	JGI		ISS
PF00112	PFAM	Papain family cysteine protease	JGI		ISS
PF08246	PFAM	Cathepsin propeptide inhibitor domain (I29)	JGI		ISS
UniRef100_I1M8Q3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M8Q3_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_O24323	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cysteine proteinase n=1 Tax=Phaseolus vulgaris RepID=O24323_PHAVU	SoyBase	E_val: 3.00E-102	ISS

Expression Patterns of Glyma14g09420

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g09420 not represented in the dataset	Glyma14g09420 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g09420 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g085600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g09420

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g09420

Limit To All Plant Sequences

>Glyma14g09420.3   sequence type=CDS   gene model=Glyma14g09420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAACATTCATCTGCCAATACAAAGAAACCCTAGTCCACGTACCTTGAACGTTTTCTGCATTCTCACTATTCTCCTCATCTTCCTCTTTTTCTCAACCAAAAGGGGTTCAATTCTAGCTAGTTCTATTACATCGTCCGCGACCATGAACATGGCGATCGTGCTTCTGTTCATGGTTTTCGCAGTTTCATCAGCTTTAGACATGTCAATAATATCACATGACAACGCTCATGCGGATAGGGCCACGAGGCGCACCGACGACGAGGTGATGTCAATGTTCGAGGAGTGGCTGGTGAAACACGACAAGGTGTACAACGCGCTCGGTGAGAAGGAGAAGAGGTTTCAAATCTTCAAGAACAATCTGCGCTTTATCGATGAACGAAACTCTCTGAACCGAACCTACAAGTTGGGACTCAACGTGTTCGCTGATCTCACCAATGCGGAGTACAGAGCCATGTACCTGCGAACCTGGGACGACGGTCCGAGGTTGGACTTGGATACGCCGCCAAGAAACCACTACGTGCCACGTGTTGGAGATACCATACCCAAATCCGTTGATTGGAGGAAGGAAGGTGCTGTTACCCCAGTCAAAAACCAAGGAGCTACTTGTAATAGCTGTTGGGCATTCACAGCAGTTGGTGCGGTGGAATCACTAGTCAAGATAAAAACAGGTGATCTAATTTCATTATCAGAACAAGAGGTGGTGGATTGTACTACATCCTCTAGTAGGGGGTGCGGTGGAGGAGATATACAACATGGCTATATCTACATCAGAAAGAATGGCATCAGTCTCGAAAAGGATTACCCTTACCGTGGTGACGAGGGTAAATGTGACTCAAATAAGAAAAATGCTATTGTTACTATTGATGGGCCACGGATGGGTTCCTACCCAACTTGA

Predicted protein sequences of Glyma14g09420

Limit To All Plant Sequences

>Glyma14g09420.3   sequence type=predicted peptide   gene model=Glyma14g09420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANIHLPIQRNPSPRTLNVFCILTILLIFLFFSTKRGSILASSITSSATMNMAIVLLFMVFAVSSALDMSIISHDNAHADRATRRTDDEVMSMFEEWLVKHDKVYNALGEKEKRFQIFKNNLRFIDERNSLNRTYKLGLNVFADLTNAEYRAMYLRTWDDGPRLDLDTPPRNHYVPRVGDTIPKSVDWRKEGAVTPVKNQGATCNSCWAFTAVGAVESLVKIKTGDLISLSEQEVVDCTTSSSRGCGGGDIQHGYIYIRKNGISLEKDYPYRGDEGKCDSNKKNAIVTIDGPRMGSYPT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain