SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g09201

Feature Type:gene_model
Chromosome:Gm14
Start:7219595
stop:7221269
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g09201
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G78120AT Annotation by Michelle Graham. TAIR10: Tetratricopeptide repeat (TPR)-like superfamily protein | chr1:29394021-29396003 REVERSE LENGTH=530 SoyBaseE_val: 2.00E-73ISS
GO:0010089GO-bp Annotation by Michelle Graham. GO Biological Process: xylem development SoyBaseN/AISS
GO:0044036GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule metabolic process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
PTHR22904Panther CHAPERONE BINDING PROTEIN JGI ISS
UniRef100_G7KAB8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Small glutamine-rich tetratricopeptide repeat-containing protein n=1 Tax=Medicago truncatula RepID=G7KAB8_MEDTR SoyBaseE_val: 6.00E-122ISS
UniRef100_UPI000233A8F4UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A8F4 related cluster n=1 Tax=unknown RepID=UPI000233A8F4 SoyBaseE_val: 3.00E-157ISS

Expression Patterns of Glyma14g09201
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g09201 not represented in the dataset
Glyma14g09201 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g09201 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g083800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g09201
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g09201
>Glyma14g09201.1   sequence type=CDS   gene model=Glyma14g09201   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGAAGAACAGTGATGAGCTTGTGCAATTTTGGAGTCAGAGGAACAACAGAGTGGACCCTGAGGAAAGATTTGAAGAGGCTTTGGCTTTGTATGACCGTGCCATTGTTGTTAACTCCAAGAAAGCAACATATCATTGCAACAAGAATGCGACTTTGATAAGCTTGGGAAGGTTTCTGCAGGCAATTGTTGAGTGTGAGGAAGCTATCAGGTTGGAGCCTTCGTGTGGCAGACCCCACAACCGTTTAGCAACAATTTATTTCAGATTGGGAAAGGCTGAAAAGGCACTGAATTGCAATGAAACAAGCCCATGTGTTGATTCCATACTTGCTTTCCAAGCTCAGGCTCTTCAAAATCACCTTAGCAGATGCACTAAAGCTCGAAAAGTCAAAGATTGGAAAGTTATATTAAAGGAATCACAGGCTACAATATCCTTGGGTGTTGATTCAGCTCCACTGGTCTATTGTTTACATACTGAAGCCTTGCTAAAGCTCTTAAGACATCAAGAGACACATGCTACCTACGAGAAAATGCCAAAATTTGACCTTGATTATTCTAACAAATTATTTGGCCCGGTTCGTAGTGCTTACCTATTGATGATAGGCACACACATTTACTTGGCAGCCGACATGTTTGAGGATGCAGTGACAACATCTCAGCAAGCATCTAAGTTAGATCCAAGTAGCTCTGAGGTGAATGCAGTGGTAAGGAGGGCCAGAGCAGTGGCATCAGCCAAAATGAGTGGTAACTTACTCTTCAAGGCATCAAAATTCACAGAAGCATATGTTGTATACAATGAAGGACTATAG
Predicted protein sequences of Glyma14g09201
>Glyma14g09201.1   sequence type=predicted peptide   gene model=Glyma14g09201   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRKNSDELVQFWSQRNNRVDPEERFEEALALYDRAIVVNSKKATYHCNKNATLISLGRFLQAIVECEEAIRLEPSCGRPHNRLATIYFRLGKAEKALNCNETSPCVDSILAFQAQALQNHLSRCTKARKVKDWKVILKESQATISLGVDSAPLVYCLHTEALLKLLRHQETHATYEKMPKFDLDYSNKLFGPVRSAYLLMIGTHIYLAADMFEDAVTTSQQASKLDPSSSEVNAVVRRARAVASAKMSGNLLFKASKFTEAYVVYNEGL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo