SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g08910

Feature Type:gene_model
Chromosome:Gm14
Start:6929172
stop:6932303
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g08910
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G26560AT Annotation by Michelle Graham. TAIR10: phospholipase A 2A | chr2:11293912-11295708 REVERSE LENGTH=407 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0002237GO-bp Annotation by Michelle Graham. GO Biological Process: response to molecule of bacterial origin SoyBaseN/AISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0008219GO-bp Annotation by Michelle Graham. GO Biological Process: cell death SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009646GO-bp Annotation by Michelle Graham. GO Biological Process: response to absence of light SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0031408GO-bp Annotation by Michelle Graham. GO Biological Process: oxylipin biosynthetic process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051607GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to virus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0071456GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to hypoxia SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016298GO-mf Annotation by Michelle Graham. GO Molecular Function: lipase activity SoyBaseN/AISS
GO:0045735GO-mf Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity SoyBaseN/AISS
KOG0513 KOG Ca2+-independent phospholipase A2 JGI ISS
PTHR10470Panther PATATIN-RELATED JGI ISS
PTHR10470:SF3Panther PATATIN-RELATED JGI ISS
PF01734PFAM Patatin-like phospholipase JGI ISS
UniRef100_G7I4H1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Patatin-like protein n=2 Tax=Medicago truncatula RepID=G7I4H1_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1M8K4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M8K4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma14g08910
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g08910 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g081300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g08910
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g08910
>Glyma14g08910.1   sequence type=CDS   gene model=Glyma14g08910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAGAGCAGAGTCATCGATTGAACAAATTCAGCCTCCAACTTATGGAAACCTAGTAACTATTCTTAGCATCGATGGGGGTGGGATTCGGGGCATCATCCCCGCTACCATTATTGGTTTCCTTGAATCCCAGCTTCAGGAGTTGGACGGTCCAGAAGCGAGGCTTGCAGACTATTTTGATGTGATATCAGGAACAAGCACAGGAGGTCTTGTAACTGCTATGATAACTGCTCCAGACAACAATAATCGACCTCTTTTCGCTGCCAAAGATATCAAGCCTTTTTACATGGACCACTGTCCTAAAATTTTCCCACAGCATAGTGGCCTTGGTGGGACGATATTAGCAAAGATGATAAGATCTCTGGGAGGACCCAAATACGACGGGAAATACCTGCATGAGGTCGTGAAAGAGAAACTTGGAGACATTCGGTTGCATGAGACACTCACCAACGTTGTCATTCCCACTTTCGACATCAAGTCTTTGCAACCCATTATTTTCTCATCTTATAAGCTTAAGATATCCCCTTGCATGGATGCTAAACTCTCAGACATATGCATCAGCACGTCTGCTGCACCTACCTATCTCCCCGCTCACAATTTCAACAATCAAGATTCAAAAGGAAACGTACACGAATTCAACCTCATTGATGGTGGTGTTTGTGCAAATAACCCGACCTTAGTTGCCATGAACGAAGTTACAAAGCAAATCATTATGCAAAATCCTGATTTCTTTCCAATTAAGCCAATGGAATATGGTCGCTTCCTAATAATTTCAATAGGCACCGGGACAGCCAAAAATGAGGAAAAATTCAATGCACAAATGGCAGCCAAATGGGGTTTATTGGATTGGCTAACCCAAAGTGGTAGTAATCCTTTAATTGATGTTTTCTCCCAATCCAGTTCAGATATGGTGGATTTTCATTTATCTGCTGTGACTCAAGCACTTCATTCAGAAGATAATTACCTTCGAATACAGGATGACACATTGACCGGAACAGATTCTTCAGTTGACATTGCTACAAAGGAGAACTTGGAGAAGCTTTGCCACGTTGGAGAAAAACTGTTAAAGAAACCAGTCTCTAGGATCAATTTAGAGAATGGTCTCTTTGAGCCACTAAAAAACAGGGAAACCAATGAAGATGCTCTTAAAAGGTTTGCAAAAATACTTTCACAAGAAAGGAGACTCCGTGAAATGAGATCCCCACACACTAAAAAGACATTCTAG
Predicted protein sequences of Glyma14g08910
>Glyma14g08910.1   sequence type=predicted peptide   gene model=Glyma14g08910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MERAESSIEQIQPPTYGNLVTILSIDGGGIRGIIPATIIGFLESQLQELDGPEARLADYFDVISGTSTGGLVTAMITAPDNNNRPLFAAKDIKPFYMDHCPKIFPQHSGLGGTILAKMIRSLGGPKYDGKYLHEVVKEKLGDIRLHETLTNVVIPTFDIKSLQPIIFSSYKLKISPCMDAKLSDICISTSAAPTYLPAHNFNNQDSKGNVHEFNLIDGGVCANNPTLVAMNEVTKQIIMQNPDFFPIKPMEYGRFLIISIGTGTAKNEEKFNAQMAAKWGLLDWLTQSGSNPLIDVFSQSSSDMVDFHLSAVTQALHSEDNYLRIQDDTLTGTDSSVDIATKENLEKLCHVGEKLLKKPVSRINLENGLFEPLKNRETNEDALKRFAKILSQERRLREMRSPHTKKTF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo