SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g08762

Feature Type:gene_model
Chromosome:Gm14
Start:6765864
stop:6768412
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g08762
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G47720AT Annotation by Michelle Graham. TAIR10: Primosome PriB/single-strand DNA-binding | chr1:17561514-17562859 REVERSE LENGTH=261 SoyBaseE_val: 9.00E-44ISS
GO:0000002GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrial genome maintenance SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0045910GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of DNA recombination SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003697GO-mf Annotation by Michelle Graham. GO Molecular Function: single-stranded DNA binding SoyBaseN/AISS
PF00436PFAM Single-strand binding protein family JGI ISS
UniRef100_G7I4I3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein OSB1 n=1 Tax=Medicago truncatula RepID=G7I4I3_MEDTR SoyBaseE_val: 5.00E-84ISS
UniRef100_UPI000233B40FUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B40F related cluster n=1 Tax=unknown RepID=UPI000233B40F SoyBaseE_val: 0ISS

Expression Patterns of Glyma14g08762
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g08762 not represented in the dataset
Glyma14g08762 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g08762 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g079900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g08762
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g08762
>Glyma14g08762.1   sequence type=CDS   gene model=Glyma14g08762   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAACCCAAACCCTTCATCTTCGCCAAGCGCTTCCCAATTCCGTTGCTTTTTTCTTATCCATTTTCTCCGCAACAACAACGTTTTCCCTTCTCCACTCACAATCGCCACTCCTTCGACGAAGCCGTTCCAGGTTGCAGCGCCGTTTACCAACACGTGCTCAAGTTCCAGCGTCCACCGACCATTCGGTGGAGCCCGCACCTCGAGAACACCGCTAGTTTCATCGGCACCGTCGCCCGCGAACCGACGCGCGTTAACTCAACAACCGGTAAATGCGGAGTTTACACCGTGCTTAAGGTTCCAAAATCCAACCAATCAAATAGCTCCTTTTTCCGGTTGCTTCTGATGATGCGGAACAATGTGGCAAAACTTGCTTCGGAACACTTGAAATTGAATGATTTTATTCAGGTTTTAGGTTCTTTGGGGTCTTTCACGAAACCTGATGCCAATGGAATCCTTAGATTGAATTACAAGTTAGAGGTGAAGGAGTTCGAGTTTGTTGCTCAAAGGTCTGGTTATCTAGGCGACAAGAAATTGGAATCTGTTGAAGTGTTTTTTTCCAATCCAAATGAGTGGTGGGATCAAAGAAAGAGCAAGCGAAATCCAAAACAGCCTGATTTTAAGCACAAGGATACCGGCGAAGCTCTGTGGCTAAGTGAGTATGATCCTCCATGGGTTAAAAGGCAACTCCAATTGTTTGACTCAAAAATTGCTGGAGGATCTGCAGGTCGTCGTTCACGTGTCACCAACTGGGTTTATGATGAGTAG
Predicted protein sequences of Glyma14g08762
>Glyma14g08762.1   sequence type=predicted peptide   gene model=Glyma14g08762   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKPKPFIFAKRFPIPLLFSYPFSPQQQRFPFSTHNRHSFDEAVPGCSAVYQHVLKFQRPPTIRWSPHLENTASFIGTVAREPTRVNSTTGKCGVYTVLKVPKSNQSNSSFFRLLLMMRNNVAKLASEHLKLNDFIQVLGSLGSFTKPDANGILRLNYKLEVKEFEFVAQRSGYLGDKKLESVEVFFSNPNEWWDQRKSKRNPKQPDFKHKDTGEALWLSEYDPPWVKRQLQLFDSKIAGGSAGRRSRVTNWVYDE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo