Glyma14g08720 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g08720

Feature Type:	gene_model
Chromosome:	Gm14
Start:	6745087
stop:	6747668
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g08720

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G47720	AT	Annotation by Michelle Graham. TAIR10: Primosome PriB/single-strand DNA-binding \| chr1:17561514-17562859 REVERSE LENGTH=261	SoyBase	E_val: 2.00E-49	ISS
GO:0000002	GO-bp	Annotation by Michelle Graham. GO Biological Process: mitochondrial genome maintenance	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0043687	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-translational protein modification	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0045910	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of DNA recombination	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0003697	GO-mf	Annotation by Michelle Graham. GO Molecular Function: single-stranded DNA binding	SoyBase	N/A	ISS
PF00436	PFAM	Single-strand binding protein family	JGI		ISS
UniRef100_G7I4I3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Protein OSB1 n=1 Tax=Medicago truncatula RepID=G7I4I3_MEDTR	SoyBase	E_val: 8.00E-95	ISS
UniRef100_UPI000233B2B9	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B2B9 related cluster n=1 Tax=unknown RepID=UPI000233B2B9	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma14g08720

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g08720 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g079700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g08720

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g08720

Limit To All Plant Sequences

>Glyma14g08720.2   sequence type=CDS   gene model=Glyma14g08720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAACCCAAACCCTTCATCTTCGCCAAGCGCTTCCCAATTCCGTTGCTTTTTTCTTTTCCATTTTCTCCGCAACAACAACGTTTTCTCTTCTCCACTCACAATCGCCACTCCTTCGACGAAGCCGTTCCAGGTTGCAGCGCCGTTTACCAACACGTGCTCAAGTTCCAGCGTCCACCGACCATTCGGTGGAGCCCGCACCTCGAGAACACCGCTAGTTTCATCGGCACCGTCGCCCGCGAACCGACGCGCGTTAACTCAACAACCGGTAAATTCGGAGTTTACACCGTGCTTAAGGTTCCAAAATCCAACCAATCAAATAGCTCCTTTTTCCGGTTGCTTCTGATGATGCGGAACAATGTGGCAAAACTTGCTTCGGAACACTTGAAATCGAATGATTTAATTCATGTTTTAGGTTCTTTGGGGTCTTTCACGAAACCTGATGCCAATGGAATCCTTCGATTGAATTACAAGTTAGAGGTGAAGGAGTTCGAGTTTGTTGCTCAAAGTTCTGGTTATCTAGGTGACAAGAAATTGGAATCTGTTGAAGCAGATGCTGGCATGCATAAAAATCAAAATCGGCTTCACCTTTGGCAAGTGTTTTTTTCCAATCCAAATGAGTGGTGGGATCAAAGAAAGAGCAAGCGAAATCCAAAACAGCCTGATTTTAAGCACAAGGATACCGGCGAAGCTCTGTGGCTAAGTGAGTATGATCCTCCATGGGTTAAAAGACAACTCCAATTGTTTGACTCAAAAATTGCTGGAGGATCTGCAGGTCGTCGTTCACGTGTCACCAACTGGGTTTATGATGAGTAG

Predicted protein sequences of Glyma14g08720

Limit To All Plant Sequences

>Glyma14g08720.2   sequence type=predicted peptide   gene model=Glyma14g08720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKPKPFIFAKRFPIPLLFSFPFSPQQQRFLFSTHNRHSFDEAVPGCSAVYQHVLKFQRPPTIRWSPHLENTASFIGTVAREPTRVNSTTGKFGVYTVLKVPKSNQSNSSFFRLLLMMRNNVAKLASEHLKSNDLIHVLGSLGSFTKPDANGILRLNYKLEVKEFEFVAQSSGYLGDKKLESVEADAGMHKNQNRLHLWQVFFSNPNEWWDQRKSKRNPKQPDFKHKDTGEALWLSEYDPPWVKRQLQLFDSKIAGGSAGRRSRVTNWVYDE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain