Report for Sequence Feature Glyma14g07940
Feature Type: gene_model
Chromosome: Gm14
Start: 6000488
stop: 6004812
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma14g07940
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G42800 AT
Annotation by Michelle Graham. TAIR10: dihydroflavonol 4-reductase | chr5:17164296-17165864 REVERSE LENGTH=382
SoyBase E_val: 1.00E-177 ISS
GO:0009718 GO-bp
Annotation by Michelle Graham. GO Biological Process: anthocyanin-containing compound biosynthetic process
SoyBase N/A ISS
GO:0009744 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus
SoyBase N/A ISS
GO:0010224 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to UV-B
SoyBase N/A ISS
GO:0044237 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular metabolic process
SoyBase N/A ISS
GO:0042406 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: extrinsic to endoplasmic reticulum membrane
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
GO:0003824 GO-mf
Annotation by Michelle Graham. GO Molecular Function: catalytic activity
SoyBase N/A ISS
GO:0045552 GO-mf
Annotation by Michelle Graham. GO Molecular Function: dihydrokaempferol 4-reductase activity
SoyBase N/A ISS
GO:0050662 GO-mf
Annotation by Michelle Graham. GO Molecular Function: coenzyme binding
SoyBase N/A ISS
KOG1502
KOG
Flavonol reductase/cinnamoyl-CoA reductase
JGI ISS
PTHR10366 Panther
NAD DEPENDENT EPIMERASE/DEHYDRATASE
JGI ISS
PTHR10366:SF9 Panther
NAD(P)H STEROID DEHYDROGENASE-RELATED
JGI ISS
PF01370 PFAM
NAD dependent epimerase/dehydratase family
JGI ISS
UniRef100_Q9SPJ5 UniRef
Annotation by Michelle Graham. Best UniRef hit: Dihydroflavonol-4-reductase DFR1 n=1 Tax=Glycine max RepID=Q9SPJ5_SOYBN
SoyBase E_val: 0 ISS
UniRef100_Q9SPJ5 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Dihydroflavonol-4-reductase DFR1 n=1 Tax=Glycine max RepID=Q9SPJ5_SOYBN
SoyBase E_val: 0 ISS
Proteins Associated with Glyma14g07940
Locus Gene Symbol Protein Name
W3 DHFR1 dihydroflavonol-4-reductase 1
W3 W3 White flower 3
Expression Patterns of Glyma14g07940
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma14g07940
Paralog Evidence Comments
Glyma17g37060 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma14g07940 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.14g072700 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma14g07940
Coding sequences of Glyma14g07940
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma14g07940.1 sequence type=CDS gene model=Glyma14g07940 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGGTTCAGCATCCGAAAGTGTTTGCGTTACAGGAGCTTCTGGTTTCATCGGGTCATGGCTTGTCATGAGACTCATCGAGCGTGGCTACACCGTTCGAGCCACCGTACGCGACCCAGTAAACATGAAGAAGGTGAAGCATTTGGTGGAACTACCAGGCGCAAAGAGCAAACTGTCTCTGTGGAAGGCTGATCTTGCTGAAGAGGGAAGCTTTGATGAAGCCATTAAAGGCTGCACCGGAGTTTTCCACGTGGCCACCCCCATGGACTTTGAATCCAAAGACCCTGAGAATGAAGTGATAAAGCCTACAATAAATGGGGTACTAGACATCATGAAAGCATGCTTGAAGGCAAAAACTGTGCGAAGGCTAATATTCACGTCCTCAGCCGGAACCCTCAACGTTATTGAGCGCCAAAAGCCCGTTTTCGACGACACATGCTGGAGTGACGTTGAGTTTTGCCGTAGAGTTAAGATGACTGGTTGGATGTATTTTGTTTCTAAAACACTGGCGGAGAAAGAAGCATGGAAATTTGCCAAAGAGCAGGGCCTGGACTTCATCACTATCATTCCACCTCTTGTTGTCGGTCCCTTTCTGATGCCAACCATGCCACCTAGCCTAATCACGGCTCTATCGCCAATCACAGGAAATGAGGACCATTACTCGATCATAAAGCAAGGTCAATTCGTCCACTTAGATGATCTCTGTCTTGCTCACATATTTCTGTTTGAGGAACCAGAAGTGGAAGGGAGGTACATATGCAGTGCATGTGACGCTACCATTCATGACATTGCCAAATTAATTAACCAAAAATACCCTGAGTACAAGGTCCCCACCAAGTTCAAGAATATTCCAGATCAATTGGAGCTTGTGAGATTTTCTTCCAAGAAGATCACAGACTTGGGATTCAAATTTAAATACAGCTTAGAGGACATGTACACTGGAGCAATTGACACATGCAGAGACAAAGGGCTTCTTCCGAAACCTGCAGAAAAAGGGCTTTTTACTAAACCTGCAGAAACTCCAGTGAATGCCATCATGCATAAATAG
Predicted protein sequences of Glyma14g07940
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma14g07940.1 sequence type=predicted peptide gene model=Glyma14g07940 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MGSASESVCVTGASGFIGSWLVMRLIERGYTVRATVRDPVNMKKVKHLVELPGAKSKLSLWKADLAEEGSFDEAIKGCTGVFHVATPMDFESKDPENEVIKPTINGVLDIMKACLKAKTVRRLIFTSSAGTLNVIERQKPVFDDTCWSDVEFCRRVKMTGWMYFVSKTLAEKEAWKFAKEQGLDFITIIPPLVVGPFLMPTMPPSLITALSPITGNEDHYSIIKQGQFVHLDDLCLAHIFLFEEPEVEGRYICSACDATIHDIAKLINQKYPEYKVPTKFKNIPDQLELVRFSSKKITDLGFKFKYSLEDMYTGAIDTCRDKGLLPKPAEKGLFTKPAETPVNAIMHK*