SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g07040

Feature Type:gene_model
Chromosome:Gm14
Start:5210898
stop:5213500
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma14g07040
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G07410AT Annotation by Michelle Graham. TAIR10: RAB GTPase homolog A2B | chr1:2276270-2277154 FORWARD LENGTH=214 SoyBaseE_val: 3.00E-131ISS
GO:0006184GO-bp Annotation by Michelle Graham. GO Biological Process: GTP catabolic process SoyBaseN/AISS
GO:0006457GO-bp Annotation by Michelle Graham. GO Biological Process: protein folding SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0006913GO-bp Annotation by Michelle Graham. GO Biological Process: nucleocytoplasmic transport SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0007264GO-bp Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0015031GO-bp Annotation by Michelle Graham. GO Biological Process: protein transport SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009504GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell plate SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
KOG0087 KOG GTPase Rab11/YPT3, small G protein superfamily JGI ISS
PTHR24073Panther FAMILY NOT NAMED JGI ISS
PTHR24073:SF213Panther SUBFAMILY NOT NAMED JGI ISS
PF00071PFAM Ras family JGI ISS
UniRef100_C9E9M0UniRef Annotation by Michelle Graham. Most informative UniRef hit: RabA2 n=1 Tax=Phaseolus vulgaris RepID=C9E9M0_PHAVU SoyBaseE_val: 1.00E-133ISS
UniRef100_I1M812UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M812_SOYBN SoyBaseE_val: 1.00E-158ISS

Expression Patterns of Glyma14g07040
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g07040
ParalogEvidenceComments
Glyma02g41940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g07040 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g064800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma14g07040
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma14g07040
>Glyma14g07040.1   sequence type=CDS   gene model=Glyma14g07040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTACAAAGTGGACCATGAATACGACTACCTCTTCAAGGTCGTATTGATTGGGGACTCCGGGGTTGGAAAATCTAACATACTTTCCAGATTTACGAGAAATGAGTTCTGCTTGGAATCTAAGTCTACTATTGGGGTTGAATTCGCAACCAGAACATTGCAGGTGGAGGGGAAGACTGTGAAGGCACAAATATGGGACACTGCAGGGCAAGAGAGGTACAGAGCTATCACCAGTGCCTACTATAGAGGAGCTGTTGGAGCCTTGTTGGTGTATGACATAACCAAGAGGCAAACATTTGACAATGTGCAGAGGTGGCTTCGCGAACTAAGGGACCATGCGGACTCCAACATTGTTATCATGATGGCTGGAAACAAATCTGACCTGAATCATCTGAGAGCAGTGTCTACTGAAGATGCTCAAAGTTTGGCTGAGAGGGAAGGTTTGTCCTTTCTAGAGACTTCAGCATTGGAGGCATACAATGTTGAGAAGGCATTCCAAACCATTTTGTTTGATATATATCACATTATAAGTAAAAAGGCACTGGCAGCACAAGAGGCTAATTCCTCTACTGGCCTTCCCCAAGGAACTACCATAAATGTCTCGAATATGTCCAGTAATGCTGGCAATAGAAGTTGTTGCTCTAACTAA
Predicted protein sequences of Glyma14g07040
>Glyma14g07040.1   sequence type=predicted peptide   gene model=Glyma14g07040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAYKVDHEYDYLFKVVLIGDSGVGKSNILSRFTRNEFCLESKSTIGVEFATRTLQVEGKTVKAQIWDTAGQERYRAITSAYYRGAVGALLVYDITKRQTFDNVQRWLRELRDHADSNIVIMMAGNKSDLNHLRAVSTEDAQSLAEREGLSFLETSALEAYNVEKAFQTILFDIYHIISKKALAAQEANSSTGLPQGTTINVSNMSSNAGNRSCCSN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo