SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g06250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g06250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g06250

Feature Type:gene_model
Chromosome:Gm14
Start:4509131
stop:4513282
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G05520AT Annotation by Michelle Graham. TAIR10: Outer membrane OMP85 family protein | chr5:1632912-1635104 FORWARD LENGTH=524 SoyBaseE_val: 0ISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051604GO-bp Annotation by Michelle Graham. GO Biological Process: protein maturation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG2602 KOG Predicted cell surface protein homologous to bacterial outer membrane proteins JGI ISS
PTHR12815Panther SORTING AND ASSEMBLY MACHINERY (SAM50) PROTEIN JGI ISS
PF01103PFAM Surface antigen JGI ISS
PF07244PFAM Surface antigen variable number repeat JGI ISS
UniRef100_G7JBW9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Sorting and assembly machinery component-like protein n=1 Tax=Medicago truncatula RepID=G7JBW9_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1M7R6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M7R6_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g06250 not represented in the dataset

Glyma14g06250 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma02g43160 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g057500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma14g06250.1   sequence type=CDS   gene model=Glyma14g06250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAAACACCGAAGAAGAAGAAGCAACTCCTCCGAACCCTAAGAATTACACTCAACACTCCACCAACGACGATGTGGAACCTCGTGACGACGAAGACATCGAAGAAGACCAAGAAAACGATGAAGACGACGTCGTTCAGGAACCGAATCGCGGAATTCCCCAATCTGCAGCGTCCAAGTTGCGGGAACAGCGTTTCAAGGTGGAAACCCTATCGCGGCGCTTGTCGTCGGAGCTGGTTCCGATCCGAGTCCACGACGTGGTCATAAACGGCAACACGAAGACGAAGGATTGGGTGATTGAAGCGGAGCTGAAAGGCATCGAGAACGCCACCAGCATGCAGGAGCTTATGCAAGCTTCGCAAATCGCCATTGCCAAGCTTCAGGGTCTCGAAATCTTCGATTCCTGCATGGTTCGCCTCGAGGCTGGACCACGAGAGCTTCCAAACACTGCCAATGTCATCGTCGACGTTGTCGAAACCGATAACAAAGTTTCCGGCGAATTCGGCATTTATACCAAACCCTCGACTAGTTCGTGGACTGCTGAAGGTGCTCTTAAGTATAAGAACTTGTTGGGTTATGGTGATCTATGTGATGCTTCTTTGGCCTATGGTGCCAACCAAGCGACTGAGGTGAGTGTAGGGGTGTATGCCCCTCGAGTTAAAGGATTTTTGACTCCTATTGTAACACGGATATCCATGCTTTCCCAAGATTGGCAGGAGTCTTCCTCATATAAGGAGCGGTTGTTGGGTGCGTATCTTGGCTTAATCTCGACAAAGCACCATGACTTAGCATACACCCTTGGATGGCGTACCTTAACAGATCCGTCAAAGAAATCATCCAGGTCTATAAGGAGGCAGCTTGGGCATGGTTTAGTGTCATCTTTGAAGTATACATTTAAAATTGATAGGAGAAATTCTACTATTAGGCCAACAAAAGGATATGTTTTTCTTTCCACCACTCATGTTGGTGGCCTTACACTGGACCCCAGGAGCTTGCGGTTTCTGCGTCAGGAGTTTGATGTTCGCTTTTCTGTCCCTTTTGGGTTTTACAATACTGCACTAAACCTTGGGATATCTGCTGGTGCTGTTTTTCCATGGGGGAATGGATTCAAAACCAAGCCATCTCCCCTTCCAGAAAGGTTTTATTTGGGTGGTGATTTTTCTCCAGTTTGCACCCTAGGAGGACCAACAACATTATGGGGATTTAAAACTAGAGGATTAGGTCCTACTGAACCTCGGAGGCAAAATAGAGATGGGTCTAATGATGACAATGTTGATTCCTCTGGATGGGACTTCATTGGTGGTGATTTTGCTGTTACTGCTTTTGCAGATCTCTCTTTTGATCTTCCAATTATGTGGTTGAGAGAACATGGAATCCACGGACATGTTTTTGCAGGTTCTGGGAATGCTGCTAAATTAACTAAGAATGAATATAAGCACTTCTCTCCTCGGAAGTTCTTAGAATCCTTTCGAATGTCAGTAGGATGTGGAGTAGTTATTCCTACTAGACTCTTCCGCTTAGAGGGTAACTACTTTTACATACTCAGAAAGGGTGAGCATGATCGTGGGAAGACTGGGTTTAGGTTTAGCTTCTCAGCGCCTTCATAG

>Glyma14g06250.1   sequence type=predicted peptide   gene model=Glyma14g06250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTNTEEEEATPPNPKNYTQHSTNDDVEPRDDEDIEEDQENDEDDVVQEPNRGIPQSAASKLREQRFKVETLSRRLSSELVPIRVHDVVINGNTKTKDWVIEAELKGIENATSMQELMQASQIAIAKLQGLEIFDSCMVRLEAGPRELPNTANVIVDVVETDNKVSGEFGIYTKPSTSSWTAEGALKYKNLLGYGDLCDASLAYGANQATEVSVGVYAPRVKGFLTPIVTRISMLSQDWQESSSYKERLLGAYLGLISTKHHDLAYTLGWRTLTDPSKKSSRSIRRQLGHGLVSSLKYTFKIDRRNSTIRPTKGYVFLSTTHVGGLTLDPRSLRFLRQEFDVRFSVPFGFYNTALNLGISAGAVFPWGNGFKTKPSPLPERFYLGGDFSPVCTLGGPTTLWGFKTRGLGPTEPRRQNRDGSNDDNVDSSGWDFIGGDFAVTAFADLSFDLPIMWLREHGIHGHVFAGSGNAAKLTKNEYKHFSPRKFLESFRMSVGCGVVIPTRLFRLEGNYFYILRKGEHDRGKTGFRFSFSAPS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo