Glyma14g00620 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g00620): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g00620): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g00620

Feature Type:	gene_model
Chromosome:	Gm14
Start:	299732
stop:	303586
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g00620

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G03475	AT	Annotation by Michelle Graham. TAIR10: Coproporphyrinogen III oxidase \| chr1:869302-871175 REVERSE LENGTH=386	SoyBase	E_val: 0	ISS
GO:0006364	GO-bp	Annotation by Michelle Graham. GO Biological Process: rRNA processing	SoyBase	N/A	ISS
GO:0006779	GO-bp	Annotation by Michelle Graham. GO Biological Process: porphyrin-containing compound biosynthetic process	SoyBase	N/A	ISS
GO:0009073	GO-bp	Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0015995	GO-bp	Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process	SoyBase	N/A	ISS
GO:0019243	GO-bp	Annotation by Michelle Graham. GO Biological Process: methylglyoxal catabolic process to D-lactate	SoyBase	N/A	ISS
GO:0019344	GO-bp	Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process	SoyBase	N/A	ISS
GO:0030154	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell differentiation	SoyBase	N/A	ISS
GO:0033014	GO-bp	Annotation by Michelle Graham. GO Biological Process: tetrapyrrole biosynthetic process	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009536	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0004109	GO-mf	Annotation by Michelle Graham. GO Molecular Function: coproporphyrinogen oxidase activity	SoyBase	N/A	ISS
KOG1518	KOG	Coproporphyrinogen III oxidase CPO/HEM13	JGI		ISS
PTHR10755	Panther	COPROPORPHYRINOGEN III OXIDASE	JGI		ISS
PF01218	PFAM	Coproporphyrinogen III oxidase	JGI		ISS
UniRef100_I1M654	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M654_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_P35055	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Coproporphyrinogen-III oxidase, chloroplastic n=1 Tax=Glycine max RepID=HEM6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma14g00620

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g00620 not represented in the dataset	Glyma14g00620 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g00620 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g003200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g00620

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g00620

Limit To All Plant Sequences

>Glyma14g00620.2   sequence type=CDS   gene model=Glyma14g00620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGCATTGTGCGAGCATTGTCTCGGCTCCGTCCTACGCGTTCCCTTTTCTCTCTGGCTCCGCTTCCACTACTCCAACTGCGATCTCGCTCACTAAGCGCAGTTGGAAGCCACCTCCGAGCATGGCAAAAGGCCCAGTCAGAGCCACCGTTTCTATAGAGAAAGAGACCCCGGAGGCCAATCGTCCCGAAACGTTTCTCAGAGGAGTGGACGAGGCCCAGTCTTCCACTTCGGTTCGGGCCCGCTTCGAGAAGATGATAAGGGAGGCCCAGGACACCGTGTGCAGTGCCCTCGAGGCCGCTGATGGTGGGGCCCAGTTCAAGGAGGACGTTTGGTCCAGGCCCGGTGGCGGCGGTGGCATTAGCAGGGTCCTTCAAGACGGTGCCGTTTGGGAGAAGGCTGGGGTTAATGTCTCTGTTGTTTACGGTGTCATGCCACCTGACGCATATCGTGCTGCCAAGGGTGTTCCTACCGATCAAAAACCTGGTCCTGTGCCTTTCTTCGCTGCTGGAATCAGCTCCGTTTTACACCCAAAGAACCCGTTTGCCCCTACCCTACATTTCAACTATCGCTATTTTGAAACCGATGCTCCTAAAGATGCTCCTGGAGCACCTAGACAATGGTGGTTTGGTGGGGGAACTGACTTGACACCAGCTTACATTTTTGAGGAGGATGTTAAGCACTTCCATTCAATTCAAAAACAAGCCTGTGACAAGTTTGAACCTACTTTTTACCCCCGATTCAAGAAATGGTGTGATGATTACTTTTATATCAAGCATCGAGGTGAAAGGAGAGGGCTTGGAGGAATATTTTTTGATGATCTTAATGACTATGATCAGGAGATGCTCCTTTCCTTTGCTACTGAATGTGCAAATTCTGTTATTCCTGCTTATTTACCTATCATAGAGAAAAGGAAGGATTTGCCCTTCAATGATCATCAGAAAGCATGGCAACAATTGCGAAGGGGACGATATGTTGAATTCAATTTGGTATATGATAGGGGTACAACATTTGGACTGAAAACTGGAGGGAGAATAGAGAGTATACTTGTTTCTCTCCCACTGACTGCTCGGTGGGAATACGATCATGTACGATTTTGGAATCTTCTTTATTTTAAACAAGTTAGATGTTAG

Predicted protein sequences of Glyma14g00620

Limit To All Plant Sequences

>Glyma14g00620.2   sequence type=predicted peptide   gene model=Glyma14g00620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMHCASIVSAPSYAFPFLSGSASTTPTAISLTKRSWKPPPSMAKGPVRATVSIEKETPEANRPETFLRGVDEAQSSTSVRARFEKMIREAQDTVCSALEAADGGAQFKEDVWSRPGGGGGISRVLQDGAVWEKAGVNVSVVYGVMPPDAYRAAKGVPTDQKPGPVPFFAAGISSVLHPKNPFAPTLHFNYRYFETDAPKDAPGAPRQWWFGGGTDLTPAYIFEEDVKHFHSIQKQACDKFEPTFYPRFKKWCDDYFYIKHRGERRGLGGIFFDDLNDYDQEMLLSFATECANSVIPAYLPIIEKRKDLPFNDHQKAWQQLRRGRYVEFNLVYDRGTTFGLKTGGRIESILVSLPLTARWEYDHVRFWNLLYFKQVRC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain