SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g45020

Feature Type:gene_model
Chromosome:Gm13
Start:44337385
stop:44341669
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g45020
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G03070AT Annotation by Michelle Graham. TAIR10: mediator subunit 8 | chr2:905978-908792 FORWARD LENGTH=524 SoyBaseE_val: 5.00E-164ISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009888GO-bp Annotation by Michelle Graham. GO Biological Process: tissue development SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0016592GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mediator complex SoyBaseN/AISS
UniRef100_I1M616UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M616_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q4V3C1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mediator of RNA polymerase II transcription subunit 8 n=1 Tax=Arabidopsis thaliana RepID=MED8_ARATH SoyBaseE_val: 2.00E-161ISS

Expression Patterns of Glyma13g45020
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g45020 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g372700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g45020
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g45020
>Glyma13g45020.1   sequence type=CDS   gene model=Glyma13g45020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGGGGCGAGGGAGGAGAGGGGTTGAACCAGGCAGTGCAGCAGCAGCTAAATCTGAAGCAAGTGAAGACCCGCGCTATCAGCCTCTTCAAAGCCATCTCTCGTATTCTTGAAGATTTCGAGGCCTACGGTCGCACCAACTCTACCCCCAAATGGCAAGACATTCTGGGTCAATATTCTATGGTCAACCTTGAGCTTTTCAACATCGTCGATGACATCAAGAAGGTGTCCAAGGCCTTTCTGGTCCATCCCAAGAATGTTAATGCCGACAATGCTACCATACTCCCTGTCATGCTTTCCTCCAAACTACTCCCTGAAATGGAGACCGACGACACCGCTAAGAGAGATCAATTGCTTCTGGGGATGCAAAACCTCCCAATTCCAACGCAAATTGAGAAGCTCAAGGCCCGTCTTGATCTGATTTCCGCAGCCTGTGAAGGTGCTGAAAAAGTGTTGGCTGACACTCGCAAAGCCTACTGCTTCGGAACTCGTCAAGGCCCAGCCGCCATTGCCCCGGCCACTCTAGACAAGGGTCAGGCTGCCAAAATTCAAGAGCAAGAAAATCTACTCCGTTCTGCTGTCAATGCCGGTGACGGATTACGGATACCAGGAGACCAGAGGCACATCACTCCTGCACAACCTCCATTGCATTTAGCAGATGCACTTCCTGTCGTCATTGCCAATGACCCTACTACTGCACAACCGCAACCACAACTCTCAGCAAACACCATGGGCATGCCTGCCCAGAATTCCTTGTTACAGGCCTCCTCCGCAACCGTATCACAACTTTTGGGAAGATCAGCAGCATCTCCTTCTGCTGCAACCACCACCACCACTTCTTTTGACAATATAACAGCTTCCCCAATCCCATATGCCAATTCACCTAGGTCTTCTACAAACATCATGAACTCTCCATCCCCTCAGCAACAACAAACCCAACAACAGCCACCAGTGCTGCAGCAGCAGCAGCAACGACAGAAATTCATGCAATTACCTCAACAGCAGCAGCAGCACCAAATTCTTGCTCAGCAGCAACAGTTCAGGCAGTCTGCAATGCAAGGACTGGGACAGTTGCACGGACAACATCAGATGCAATTTTCTCAACCACTTGGGCACCAGCAATTTCAGGGTAGGCAGCTGCCTTCAGGACATGTTCAGCATGGCATTGGTCAAAGCCAACTCAATCAAGGAAACCAAATGACTCGATTAAGCCAGTTTTCTGGTCCTGCTAACAGTGCGCTATTCAGTGCTGCTCAAACAACACCTAATACTCAAATGATTCCAAACATTTCCGGCACATTACCTTCACAGTCCCTTCTCCCACGGGTGCAGTTAGGATTATCTGGAAACAACCCTCAGCGAAGTCATCCTTCCCAAATGTTGAGTGATCAGGTGTTTAACATGGGAGGTGGCAATCCTGGTGGTATGATGCCCATACAACAGCAGCAGCAGCAGCAGCAGCAGCAACAACATGGTTCACAAGCATTTGGTAGCATGGCAAATGCTCAGAATCTACAATCTGGGTTGGTGACACTTCAAAACACACAACAGAATCACCCCAATTTCTCTCAGCAGAGACAGCAAAATCCACAGTGA
Predicted protein sequences of Glyma13g45020
>Glyma13g45020.1   sequence type=predicted peptide   gene model=Glyma13g45020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGGEGGEGLNQAVQQQLNLKQVKTRAISLFKAISRILEDFEAYGRTNSTPKWQDILGQYSMVNLELFNIVDDIKKVSKAFLVHPKNVNADNATILPVMLSSKLLPEMETDDTAKRDQLLLGMQNLPIPTQIEKLKARLDLISAACEGAEKVLADTRKAYCFGTRQGPAAIAPATLDKGQAAKIQEQENLLRSAVNAGDGLRIPGDQRHITPAQPPLHLADALPVVIANDPTTAQPQPQLSANTMGMPAQNSLLQASSATVSQLLGRSAASPSAATTTTTSFDNITASPIPYANSPRSSTNIMNSPSPQQQQTQQQPPVLQQQQQRQKFMQLPQQQQQHQILAQQQQFRQSAMQGLGQLHGQHQMQFSQPLGHQQFQGRQLPSGHVQHGIGQSQLNQGNQMTRLSQFSGPANSALFSAAQTTPNTQMIPNISGTLPSQSLLPRVQLGLSGNNPQRSHPSQMLSDQVFNMGGGNPGGMMPIQQQQQQQQQQQHGSQAFGSMANAQNLQSGLVTLQNTQQNHPNFSQQRQQNPQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo