SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G13320 | AT | Annotation by Michelle Graham. TAIR10: cation exchanger 2 | chr3:4315418-4317997 FORWARD LENGTH=441 | SoyBase | E_val: 0 | ISS |
| GO:0000041 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transition metal ion transport | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0006812 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cation transport | SoyBase | N/A | ISS |
| GO:0006816 | GO-bp | Annotation by Michelle Graham. GO Biological Process: calcium ion transport | SoyBase | N/A | ISS |
| GO:0006820 | GO-bp | Annotation by Michelle Graham. GO Biological Process: anion transport | SoyBase | N/A | ISS |
| GO:0006828 | GO-bp | Annotation by Michelle Graham. GO Biological Process: manganese ion transport | SoyBase | N/A | ISS |
| GO:0006862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nucleotide transport | SoyBase | N/A | ISS |
| GO:0006882 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular zinc ion homeostasis | SoyBase | N/A | ISS |
| GO:0006888 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport | SoyBase | N/A | ISS |
| GO:0009624 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to nematode | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0015691 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cadmium ion transport | SoyBase | N/A | ISS |
| GO:0015696 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ammonium transport | SoyBase | N/A | ISS |
| GO:0015802 | GO-bp | Annotation by Michelle Graham. GO Biological Process: basic amino acid transport | SoyBase | N/A | ISS |
| GO:0030001 | GO-bp | Annotation by Michelle Graham. GO Biological Process: metal ion transport | SoyBase | N/A | ISS |
| GO:0043069 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death | SoyBase | N/A | ISS |
| GO:0043090 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid import | SoyBase | N/A | ISS |
| GO:0043269 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of ion transport | SoyBase | N/A | ISS |
| GO:0055085 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transmembrane transport | SoyBase | N/A | ISS |
| GO:0005773 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuole | SoyBase | N/A | ISS |
| GO:0009705 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane | SoyBase | N/A | ISS |
| GO:0012505 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: endomembrane system | SoyBase | N/A | ISS |
| GO:0008324 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity | SoyBase | N/A | ISS |
| GO:0015368 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: calcium:cation antiporter activity | SoyBase | N/A | ISS |
| GO:0015369 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: calcium:hydrogen antiporter activity | SoyBase | N/A | ISS |
| KOG1397 | KOG | Ca2+/H+ antiporter VCX1 and related proteins | JGI | ISS | |
| PF01699 | PFAM | Sodium/calcium exchanger protein | JGI | ISS | |
| UniRef100_C8CBQ5 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Cation exchanger 2 n=1 Tax=Cucumis sativus RepID=C8CBQ5_CUCSA | SoyBase | E_val: 0 | ISS |
| UniRef100_I1M610 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M610_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma13g44960 not represented in the dataset |
Glyma13g44960 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma15g00380 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.13g372100 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma13g44960.1 sequence type=CDS gene model=Glyma13g44960 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGATGGGTTCCGTTCTAGAGGACAAGATAGACCGTCATAGTTTTCACGACCACCACGACGCCGACGATACTCCCTTAGCATCTTCCTCTTCTAAAGTCCTCCAACAATTACACAGCTTCGATTTTGAGGACACAAGCGTTGTAGATTTGCGGAGCTCATCCATCTTTAACACAACACGTATCAGCAGGAGTATATACGTCGTCTTAATTAAAGCCAAGATCAACCTCTTGCTTCCCTTTGGTCCATTGGCCATTCTCCTACATTATCTAACTGGACACCATGGATGGGTCTTTTTCTTCACCTTATTGGGGATTACTCCTTTGGCAGAACGCCTCGGTTATGCTACCGAGCAGCTTGCCTTCTACACAGGACCCACAGTTGGGGGTCTGCTTAATGCCACATTCGGCAATGCAACTGAAATGATTATATCAATTTATGCATTGGAAAGCAATATGATAAGGGTTGTTCAGCAATCTTTACTCGGTTCAATCTTGTCAAATATGCTTCTAGTTCTTGGCTGTGCATTCTTTACTGGTGGCATTGTCCACTACAAAAAAGTGCAGGTTTTTGATAAGGCAGCTGCTGTTGTCAATTCTGGGTTACTCTTGATGGCTGTAATGGGAATACTATTTCCTGCTGTGCTTTACTTTACTCACTCCGAAGTTCATCAAGGGAAGTCAGTCTTATCTCTTTCAAGATTTAGCAGCTGCATAATGCTACTGGCCTATGCAAGCTACCTTTTCTTTCAACTTAGAAGTCAGCAAAATGTTTATAGTCCAGTTGACGAGGAAGGAGATAATGGTGAAAATTCTGATGAGGAGGAAGAACATGAATTAACTCAATGGGAGGCAATTATCTGGCTTGCTATCTTGACAGCATGGGTATCTATATTGTCTGGATACCTTGTAGACGCCATACAGGGAGCATCTGAGTCATTGAATATGTCAGTGGCTTTTATTTCTGTCATCTTGCTTCCAATTGTAGGCAATGCTGCAGAACATGCCAGTGCTATCATGTTTGCCGTGAAGGACAAGCTTGATATCACTATTGGAGTTGCTATTGGATCGTCTACACAGATATCTATGTTTGTGATCCCTTTCTGTGTAGTTGTTGGATGGTGCATGGGAAAAGAAATGGACTTGAATTTTCAACTATTCGAGACTGCCACGCTTTTTATCACTGTGTTAGTAGTTGCATTTATGATGCAGGAAGGAACCTCAAATTATTTTAAAGGGTTGATGCTTATTCTATGCTATCTAATAGTTGCTGCCAGTTTTTTCGTACATGTAGACCCTAAAAGTGGTGATGACTAA
>Glyma13g44960.1 sequence type=predicted peptide gene model=Glyma13g44960 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MMGSVLEDKIDRHSFHDHHDADDTPLASSSSKVLQQLHSFDFEDTSVVDLRSSSIFNTTRISRSIYVVLIKAKINLLLPFGPLAILLHYLTGHHGWVFFFTLLGITPLAERLGYATEQLAFYTGPTVGGLLNATFGNATEMIISIYALESNMIRVVQQSLLGSILSNMLLVLGCAFFTGGIVHYKKVQVFDKAAAVVNSGLLLMAVMGILFPAVLYFTHSEVHQGKSVLSLSRFSSCIMLLAYASYLFFQLRSQQNVYSPVDEEGDNGENSDEEEEHELTQWEAIIWLAILTAWVSILSGYLVDAIQGASESLNMSVAFISVILLPIVGNAAEHASAIMFAVKDKLDITIGVAIGSSTQISMFVIPFCVVVGWCMGKEMDLNFQLFETATLFITVLVVAFMMQEGTSNYFKGLMLILCYLIVAASFFVHVDPKSGDD*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
