SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g44230

Feature Type:gene_model
Chromosome:Gm13
Start:43724875
stop:43731379
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g44230
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G15340AT Annotation by Michelle Graham. TAIR10: methyl-CPG-binding domain 10 | chr1:5275895-5277474 REVERSE LENGTH=384 SoyBaseE_val: 2.00E-49ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0008327GO-mf Annotation by Michelle Graham. GO Molecular Function: methyl-CpG binding SoyBaseN/AISS
PF01429PFAM Methyl-CpG binding domain JGI ISS
UniRef100_B9RV64UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nucleosome-binding protein, putative n=1 Tax=Ricinus communis RepID=B9RV64_RICCO SoyBaseE_val: 2.00E-62ISS
UniRef100_I1M5U1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M5U1_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g44230
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g44230
ParalogEvidenceComments
Glyma15g01040 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g44230 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g365500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g44230
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g44230
>Glyma13g44230.1   sequence type=CDS   gene model=Glyma13g44230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAATGCGGAGGAGCAGCAGCAGCAAAACGAGGAGGTTTTGTCGGTTGAACTTCCGGCTCCTTCCGGTTGGAATAAACTGTTCTTCCCTAAGAAAGTGGGAACACCAAGAAAAAGTGAGATTGTATTCATTGCTCCAACTGGGGAGGAGATCAATACCAAAAAACAATTGGAGCAGTACCTAAAGGCACATCCTGGCAATCCTGTCATTTCAGAGTTTGACTGGGGAACTGGTGAGACCCCCAGGCGATCAGCAAGGATCAGTGAGAAGGTCAAGTCAACTCCACCAGCAGATAGTGATACTCCAAAGAAACGTGCTCGGAAATCATCAGGATCAAAGAAGGATAACAAAGAAACTGAATCTGCTTCAGAGGAAGGCAAGGCAAAGTCTGAAACTGAAGATCCCAAGGCTGCAGAGGAGGAGGAGGATAATGAAGGAAACAATGATTCTGGAGGAAAGCAACTTGAGAATGGAGATAAAACTGAACAAATTGATGAAAAAGCCAAGAAGTCAGACGTAGATATGGAAGAAACTGATCTGAATGATACTAACAATAAATTAGAAAATGATTCAGCGGAAATTAAGAATAGTCATGTGAAAGGGGAAAATGTGATTACTGAAAAGCCTGAAGGTGAAGAAGCACAAAAGCTTGAAATTGAACCAGCAGAGAAAGTTGCCGAAGAAGCGGCGGACACTGAAAAATCCCAAGGGCCCCTACTGACTACTGAATTAGAAAAAGAAGAGAATGAGGAGAAAACAGATACTGTGATTCTAGATGCTAATGGGGGAGTCGAGAAAGAGAATCCTAATGCTGCTGCAGAAATGTAA
Predicted protein sequences of Glyma13g44230
>Glyma13g44230.1   sequence type=predicted peptide   gene model=Glyma13g44230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENAEEQQQQNEEVLSVELPAPSGWNKLFFPKKVGTPRKSEIVFIAPTGEEINTKKQLEQYLKAHPGNPVISEFDWGTGETPRRSARISEKVKSTPPADSDTPKKRARKSSGSKKDNKETESASEEGKAKSETEDPKAAEEEEDNEGNNDSGGKQLENGDKTEQIDEKAKKSDVDMEETDLNDTNNKLENDSAEIKNSHVKGENVITEKPEGEEAQKLEIEPAEKVAEEAADTEKSQGPLLTTELEKEENEEKTDTVILDANGGVEKENPNAAAEM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo