SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g42785): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g42785): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g42785

Feature Type:gene_model
Chromosome:Gm13
Start:42657881
stop:42658818
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G73010AT Annotation by Michelle Graham. TAIR10: phosphate starvation-induced gene 2 | chr1:27464780-27466180 REVERSE LENGTH=295 SoyBaseE_val: 6.00E-58ISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0051262GO-bp Annotation by Michelle Graham. GO Biological Process: protein tetramerization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004427GO-mf Annotation by Michelle Graham. GO Molecular Function: inorganic diphosphatase activity SoyBaseN/AISS
GO:0016462GO-mf Annotation by Michelle Graham. GO Molecular Function: pyrophosphatase activity SoyBaseN/AISS
GO:0016791GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphatase activity SoyBaseN/AISS
PTHR20889Panther PHOSPHATASE, ORPHAN 1, 2 JGI ISS
PF06888PFAM Putative Phosphatase JGI ISS
UniRef100_G7ZWH8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pyridoxal phosphate phosphatase PHOSPHO2 n=1 Tax=Medicago truncatula RepID=G7ZWH8_MEDTR SoyBaseE_val: 4.00E-62ISS
UniRef100_UPI000233B0A1UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B0A1 related cluster n=1 Tax=unknown RepID=UPI000233B0A1 SoyBaseE_val: 5.00E-82ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g42785 not represented in the dataset

Glyma13g42785 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g351700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g42785.1   sequence type=CDS   gene model=Glyma13g42785   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGGAATTGTGGTGATTTTTTACTTCGACAAGACCATTGTCGACTGTGACAGTGATAATTGGGTTGTTGACGAGTTGGGTTTCAATGAATTGTTCAATCGGCTCCTTCCCACGATGCCTTGGAACACTCTCATGGATAAGATGATGATGGAGCTTCATTCCCATGAAAAAATCATTGAGGGCATTGTCCAAGTTCTTCAGAGGATTCCTATACACCCCAGAATAACCGGTGCCATTAAAGCAGCACATGTTTTAGGGTGTGATTTAAGGATTGTAAGCGATGCAAATATGTTCTTCATCAAGACAATTTTAAAGCACTTAAAAATAAGGGAATGCTTCTCAGAGATCAACACCAACCCAGATTAA

>Glyma13g42785.1   sequence type=predicted peptide   gene model=Glyma13g42785   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGIVVIFYFDKTIVDCDSDNWVVDELGFNELFNRLLPTMPWNTLMDKMMMELHSHEKIIEGIVQVLQRIPIHPRITGAIKAAHVLGCDLRIVSDANMFFIKTILKHLKIRECFSEINTNPD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo