Glyma13g42785 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g42785): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g42785): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g42785

Feature Type:	gene_model
Chromosome:	Gm13
Start:	42657881
stop:	42658818
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g42785

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G73010	AT	Annotation by Michelle Graham. TAIR10: phosphate starvation-induced gene 2 \| chr1:27464780-27466180 REVERSE LENGTH=295	SoyBase	E_val: 6.00E-58	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0016036	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation	SoyBase	N/A	ISS
GO:0019375	GO-bp	Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0051262	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein tetramerization	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0004427	GO-mf	Annotation by Michelle Graham. GO Molecular Function: inorganic diphosphatase activity	SoyBase	N/A	ISS
GO:0016462	GO-mf	Annotation by Michelle Graham. GO Molecular Function: pyrophosphatase activity	SoyBase	N/A	ISS
GO:0016791	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphatase activity	SoyBase	N/A	ISS
PTHR20889	Panther	PHOSPHATASE, ORPHAN 1, 2	JGI		ISS
PF06888	PFAM	Putative Phosphatase	JGI		ISS
UniRef100_G7ZWH8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Pyridoxal phosphate phosphatase PHOSPHO2 n=1 Tax=Medicago truncatula RepID=G7ZWH8_MEDTR	SoyBase	E_val: 4.00E-62	ISS
UniRef100_UPI000233B0A1	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B0A1 related cluster n=1 Tax=unknown RepID=UPI000233B0A1	SoyBase	E_val: 5.00E-82	ISS

Expression Patterns of Glyma13g42785

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g42785 not represented in the dataset	Glyma13g42785 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g42785 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g351700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g42785

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g42785

Limit To All Plant Sequences

>Glyma13g42785.1   sequence type=CDS   gene model=Glyma13g42785   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGGAATTGTGGTGATTTTTTACTTCGACAAGACCATTGTCGACTGTGACAGTGATAATTGGGTTGTTGACGAGTTGGGTTTCAATGAATTGTTCAATCGGCTCCTTCCCACGATGCCTTGGAACACTCTCATGGATAAGATGATGATGGAGCTTCATTCCCATGAAAAAATCATTGAGGGCATTGTCCAAGTTCTTCAGAGGATTCCTATACACCCCAGAATAACCGGTGCCATTAAAGCAGCACATGTTTTAGGGTGTGATTTAAGGATTGTAAGCGATGCAAATATGTTCTTCATCAAGACAATTTTAAAGCACTTAAAAATAAGGGAATGCTTCTCAGAGATCAACACCAACCCAGATTAA

Predicted protein sequences of Glyma13g42785

Limit To All Plant Sequences

>Glyma13g42785.1   sequence type=predicted peptide   gene model=Glyma13g42785   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGIVVIFYFDKTIVDCDSDNWVVDELGFNELFNRLLPTMPWNTLMDKMMMELHSHEKIIEGIVQVLQRIPIHPRITGAIKAAHVLGCDLRIVSDANMFFIKTILKHLKIRECFSEINTNPD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain