Glyma13g42720 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g42720): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g42720): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g42720

Feature Type:	gene_model
Chromosome:	Gm13
Start:	42617423
stop:	42618717
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g42720

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G55180	AT	Annotation by Michelle Graham. TAIR10: phospholipase D alpha 4 \| chr1:20585057-20587629 REVERSE LENGTH=762	SoyBase	E_val: 5.00E-76	ISS
GO:0006970	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to osmotic stress	SoyBase	N/A	ISS
GO:0006995	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to nitrogen starvation	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009395	GO-bp	Annotation by Michelle Graham. GO Biological Process: phospholipid catabolic process	SoyBase	N/A	ISS
GO:0009791	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-embryonic development	SoyBase	N/A	ISS
GO:0016036	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation	SoyBase	N/A	ISS
GO:0016049	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell growth	SoyBase	N/A	ISS
GO:0045848	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of nitrogen utilization	SoyBase	N/A	ISS
GO:0046470	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphatidylcholine metabolic process	SoyBase	N/A	ISS
GO:0048364	GO-bp	Annotation by Michelle Graham. GO Biological Process: root development	SoyBase	N/A	ISS
GO:0051301	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell division	SoyBase	N/A	ISS
GO:0051365	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to potassium ion starvation	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004630	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phospholipase D activity	SoyBase	N/A	ISS
GO:0005509	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion binding	SoyBase	N/A	ISS
PTHR18896	Panther	PHOSPHOLIPASE D	JGI		ISS
PTHR18896:SF30	Panther	PLDEPSILON (PHOSPHOLIPASE D ALPHA 4), PHOSPHOLIPAS	JGI		ISS
UniRef100_I1MCY6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Phospholipase D n=1 Tax=Glycine max RepID=I1MCY6_SOYBN	SoyBase	E_val: 7.00E-121	ISS
UniRef100_UPI000233B5E6	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B5E6 related cluster n=1 Tax=unknown RepID=UPI000233B5E6	SoyBase	E_val: 2.00E-126	ISS

Expression Patterns of Glyma13g42720

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g42720 not represented in the dataset	Glyma13g42720 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g42720 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g351100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g42720

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g42720

Limit To All Plant Sequences

>Glyma13g42720.1   sequence type=CDS   gene model=Glyma13g42720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGAAAAACCTAAGCTCCTCTTCCATGGAACAATTCAAGCTACCATCTTCAATGCCACACCTTACTCACCTTCGTTTCCCTTCAATTGTGTATGTACAAATGGAAAGCCTGCTTATGTGACCATCAACATAGATAACAAGAAGGTGGCGAAAACGACTCAAGAACGTGAATGTTTGTGGAACCAAACCTTTCAGATTCAGTGTGCTCATCCAGAAGACTCAACAATCACAATTACACTGAAATCATCATGCTCCATTTTGGGGAGATTTCACATGCAGGCCAAGCGATTCATGTTATGGTTCAAGCCAGCAGATATGGAACCAAGCTGGACAAAGCTACTAAGCAATGGGAAATTTCAAGAGCTGAGGGATGCTACATTCCCACAAAGGTCTAATTGCCAGGTTAAACTCTATCATGATGCTCACCATTCCTCTACTTTCCACCCTCCTTTTGATCTATGTGGAGCACCAAGAAAGCTGTGGGAAGATGTCTATAAAGCCATTGAGGGTGCAAAATATTTGGTTAGAGATCCTCAAACAGAAATCCCACATGCTAGGGAGATAAAGCTAGGTGAGCTATTGAAGAAGAAGGCAGAGGAAGGAGTGGCTGTGAGGGTTAACAAAATTGTAAAGAATATTTAA

Predicted protein sequences of Glyma13g42720

Limit To All Plant Sequences

>Glyma13g42720.1   sequence type=predicted peptide   gene model=Glyma13g42720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEKPKLLFHGTIQATIFNATPYSPSFPFNCVCTNGKPAYVTINIDNKKVAKTTQERECLWNQTFQIQCAHPEDSTITITLKSSCSILGRFHMQAKRFMLWFKPADMEPSWTKLLSNGKFQELRDATFPQRSNCQVKLYHDAHHSSTFHPPFDLCGAPRKLWEDVYKAIEGAKYLVRDPQTEIPHAREIKLGELLKKKAEEGVAVRVNKIVKNI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain