SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g42470

Feature Type:gene_model
Chromosome:Gm13
Start:42456366
stop:42459148
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g42470
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G08520AT Annotation by Michelle Graham. TAIR10: SNARE-like superfamily protein | chr4:5417887-5420295 FORWARD LENGTH=181 SoyBaseE_val: 2.00E-93ISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0030125GO-cc Annotation by Michelle Graham. GO Cellular Compartment: clathrin vesicle coat SoyBaseN/AISS
KOG3343 KOG Vesicle coat complex COPI, zeta subunit JGI ISS
PTHR11043Panther ZETA-COAT PROTEIN JGI ISS
PF01217PFAM Clathrin adaptor complex small chain JGI ISS
UniRef100_I1M5A9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M5A9_SOYBN SoyBaseE_val: 4.00E-129ISS
UniRef100_Q9MAZ9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nonclathrin coat protein zeta1-COP n=1 Tax=Glycine max RepID=Q9MAZ9_SOYBN SoyBaseE_val: 6.00E-117ISS

Expression Patterns of Glyma13g42470
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g42470 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g348700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g42470
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g42470
>Glyma13g42470.1   sequence type=CDS   gene model=Glyma13g42470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCTTATGGCTCATGTCCGTCGATAAAGAATATTCTTCTTCTAGACTCAGAGGGAAAGCGTGTGGCAGTCAAGTATTTTTCAGACGACTGGCCAACCAACAACTCAAAGATCGCTTTTGAGAAGTTTGTGTTTAGTAAGACTGTTAAGACAAATGCTCGAACAGAAGCTGAGATCACATTACTCGACAACAATATCATTATTTACAAATTTGTACAAGATCTCCATTTCTTTGTCACTGGTGGCGATGATGCAAATGAGATCATTTTAGCTTCAGTTCTTCAGGGTTTCTTTGATGCAATCACGCTTCTCTTGAGGAACAATGTTGACAAAAGAGAGGCGCTGGAAAACTTGGACCTCATTCTTTTATGCCTTGATGAGATTGTTGATGGAGGGATGATACTTGAAACAAATGGACCACTTATTGCTGAAAAAGTTACCTCCCATAGCATGGATGGTGCTGAATCCCCCCTGTCTGAGCAGACACTAACTCAAGCCTGGGCTACAGCTAGAGAACATTTGACAAGAACCCTTCTAAAATAA
Predicted protein sequences of Glyma13g42470
>Glyma13g42470.1   sequence type=predicted peptide   gene model=Glyma13g42470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASYGSCPSIKNILLLDSEGKRVAVKYFSDDWPTNNSKIAFEKFVFSKTVKTNARTEAEITLLDNNIIIYKFVQDLHFFVTGGDDANEIILASVLQGFFDAITLLLRNNVDKREALENLDLILLCLDEIVDGGMILETNGPLIAEKVTSHSMDGAESPLSEQTLTQAWATAREHLTRTLLK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo