SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma13g42210

Feature Type:gene_model
Chromosome:Gm13
Start:42265611
stop:42266860
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G54420AT Annotation by Michelle Graham. TAIR10: homolog of carrot EP3-3 chitinase | chr3:20145935-20147034 FORWARD LENGTH=273 SoyBaseE_val: 1.00E-134ISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010262GO-bp Annotation by Michelle Graham. GO Biological Process: somatic embryogenesis SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0015824GO-bp Annotation by Michelle Graham. GO Biological Process: proline transport SoyBaseN/AISS
GO:0016998GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule catabolic process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0004568GO-mf Annotation by Michelle Graham. GO Molecular Function: chitinase activity SoyBaseN/AISS
GO:0008061GO-mf Annotation by Michelle Graham. GO Molecular Function: chitin binding SoyBaseN/AISS
KOG4742 KOG Predicted chitinase JGI ISS
PTHR22595Panther CHITINASE-RELATED JGI ISS
PTHR22595:SF7Panther CLASS IV CHITINASE JGI ISS
PF00182PFAM Chitinase class I JGI ISS
PF00187PFAM Chitin recognition protein JGI ISS
UniRef100_I1M587UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M587_SOYBN SoyBaseE_val: 0ISS
UniRef100_P27054UniRef Annotation by Michelle Graham. Most informative UniRef hit: Endochitinase PR4 n=1 Tax=Phaseolus vulgaris RepID=CHI4_PHAVU SoyBaseE_val: 4.00E-156ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g346700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g42210.1   sequence type=CDS   gene model=Glyma13g42210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATAGGAAAGAAATTCTTATGCGTTGTTGTAGCGGTGGCCTTTGTTATGATAACAAAGGTGCCCCAAAATGTGAGTGCTCAAAACTGTGGTTGTGCTGAAGGGTTATGTTGCAGCCAACATGGGTATTGTGGTAACGGTGAGGAGTACTGCGGCACAGGGTGCAAGCAGGGTCCTTGTTATTCGAGCACACCAAGTACTAACAATGTTAATGTGGCTGACATTGTCACACCACAATTCTTCAGTGGCATAATTGATCAGGCTGACTCTGGCTGTGCTGGCAAGAACTTTTACTCACGAGATGCTTTTCTTAATGCTCTCAATTCCTATAATGACTTTGGTAGACTTGGTTCCCAGGATGACTCCAAGCGCGAGATTGCAGCTGCTTTTGCCCATTTCACACATGAAACTGGACATTTTTGCCACATTGAAGAGATTAATGGTGCATCGCAGGACTACTGCGACGAGAATACGATTTCACAGTATCCGTGCCTTTCTAACAGAGGCTACTATGGGCGTGGTCCGATTCAACTAACATGGAACTTCAACTATGGACCTGCTGGACAGAGCAACGATTTTGATGGATTGAACGCTCCTGAAACAGTGGGCAATGATCCTGTGATTTCTTTCAAGACAGCACTGTGGTACTGGATGCAACACGTGCGCCCTGTCATCAACCAAGGCTTTGGTGCAACCATCAGAGCCATTAACGGTCAACTTGAATGTGATGGTGCCAACCCTTCCACAGTTCAGGCTCGCGTTAATTACTACACTGACTACTGTAGACAATTCGGTGTTGCCACCGGTGATAATCTTACTTGCTAA

>Glyma13g42210.1   sequence type=predicted peptide   gene model=Glyma13g42210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIGKKFLCVVVAVAFVMITKVPQNVSAQNCGCAEGLCCSQHGYCGNGEEYCGTGCKQGPCYSSTPSTNNVNVADIVTPQFFSGIIDQADSGCAGKNFYSRDAFLNALNSYNDFGRLGSQDDSKREIAAAFAHFTHETGHFCHIEEINGASQDYCDENTISQYPCLSNRGYYGRGPIQLTWNFNYGPAGQSNDFDGLNAPETVGNDPVISFKTALWYWMQHVRPVINQGFGATIRAINGQLECDGANPSTVQARVNYYTDYCRQFGVATGDNLTC*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo