Report for Sequence Feature Glyma13g41280
Feature Type: gene_model
Chromosome: Gm13
Start: 41625236
stop: 41627233
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma13g41280
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G29070 AT
Annotation by Michelle Graham. TAIR10: Ubiquitin fusion degradation UFD1 family protein | chr2:12487797-12489335 FORWARD LENGTH=312
SoyBase E_val: 8.00E-111 ISS
GO:0006511 GO-bp
Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
KOG1816
KOG
Ubiquitin fusion-degradation protein
JGI ISS
PTHR12555 Panther
UBIQUITIN FUSION DEGRADATON PROTEIN 1
JGI ISS
PF03152 PFAM
Ubiquitin fusion degradation protein UFD1
JGI ISS
UniRef100_B9T677 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin fusion degradaton protein, putative n=1 Tax=Ricinus communis RepID=B9T677_RICCO
SoyBase E_val: 3.00E-121 ISS
UniRef100_UPI000233AF2F UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233AF2F related cluster n=1 Tax=unknown RepID=UPI000233AF2F
SoyBase E_val: 0 ISS
Expression Patterns of Glyma13g41280
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma13g41280
Paralog Evidence Comments
Glyma15g04140 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma13g41280 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.13g337800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma13g41280
Coding sequences of Glyma13g41280
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma13g41280.2 sequence type=CDS gene model=Glyma13g41280 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCAAACCTTTGAACAGTTTTATCGTTGTTACCCTGTTTCCTTCATTGAGAAGCCAGATCTGGAAAAAGGTGATAAAATTATCATGCCTCCCTCAGCCCTTGATCGCCTTGCGTCTTTGCACATAGAGTACCCCATGTTATTTCAAATTAAAAATCCTTCTGCTGAAAGAGTTACTCACTGTGGGGTGCTAGAATTCGTATCTGATGAAGGGACCATATATATACACCATAATGGGTATGCCATGATGGAAAATATGCTTCTCCAAGAGGGAGACATTGTAAAAGTGAAAATTGCCACCCTTGCAAAAGGAACCTTAGAGACTACACTTAGGAGCTACTCATGTTTAACAGCCGGTGACACTATAATGGTTCCTTATAACAACAAGAAGTATTACATCGACATAGTTGAAACTATACCCTCTCCTGCAGTCATTATAATTGAAACAGACTGTGAAGTTGATTTTGCTCCACCTCTTGATTATAAAGAACCTGAGAAACAAGCAAAACCTGTTGTATTTGACAGGAAACAACCAGAAGTTGAGGATGAGCCGCCAGCAAAGATTGCCCGGTTGACTCCATTCACTGTTTCTGGAAGACATTTGGATGGTAAACCTTCAGCACAATCAGTCGAACAAGCATCCTCTTCAGAGCTAAAACAGAAACAAACTGACAAAGAAATCAAGGGTTCTGATTCTAAGTCATCAAATACCGTGTCTCGTAGACATTCAGGAAAGCTTGTGTTTGGGTCAAATGCTACTACATCTGACGTTCAAACAACACCTAAGGTTTCTCAAGAAAACACCTGTAAAGAGAAATCTCAGAAGGAACAAGAGCCAAAATTCAAAGCTTTCACGGGAAAGAAGTATTCATTAAAAAGTTGA
Predicted protein sequences of Glyma13g41280
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma13g41280.2 sequence type=predicted peptide gene model=Glyma13g41280 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MQTFEQFYRCYPVSFIEKPDLEKGDKIIMPPSALDRLASLHIEYPMLFQIKNPSAERVTHCGVLEFVSDEGTIYIHHNGYAMMENMLLQEGDIVKVKIATLAKGTLETTLRSYSCLTAGDTIMVPYNNKKYYIDIVETIPSPAVIIIETDCEVDFAPPLDYKEPEKQAKPVVFDRKQPEVEDEPPAKIARLTPFTVSGRHLDGKPSAQSVEQASSSELKQKQTDKEIKGSDSKSSNTVSRRHSGKLVFGSNATTSDVQTTPKVSQENTCKEKSQKEQEPKFKAFTGKKYSLKS*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
