SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g40090

Feature Type:gene_model
Chromosome:Gm13
Start:40653689
stop:40654927
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g40090
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G60680AT Annotation by Michelle Graham. TAIR10: Protein of unknown function, DUF584 | chr5:24386247-24386738 FORWARD LENGTH=163 SoyBaseE_val: 8.00E-40ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF04520PFAM Protein of unknown function, DUF584 JGI ISS
UniRef100_Q9FF51UniRef Annotation by Michelle Graham. Most informative UniRef hit: Emb|CAB72159.1 n=1 Tax=Arabidopsis thaliana RepID=Q9FF51_ARATH SoyBaseE_val: 4.00E-37ISS
UniRef100_UPI0001B637BBUniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001B637BB related cluster n=1 Tax=unknown RepID=UPI0001B637BB SoyBaseE_val: 9.00E-108ISS

Expression Patterns of Glyma13g40090
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g40090
ParalogEvidenceComments
Glyma12g29471 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g40090 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g325800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g40090
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g40090
>Glyma13g40090.1   sequence type=CDS   gene model=Glyma13g40090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCACCAACATTCGTAGAGCAACCTATCGCTTTCTCCCTGCCATGGACACAGATTCTTTCTCCGATTCCACCTTCGAATTCCACGAATCCGATCTCTACAACTCCGCGCGCGCTAACTCTCCCGAACTTGCCAAATCCGTACGCTCCTCCAGATTTCACAACTACTCCTCTTCCTCTGCCGCCCGCGTCGGTGCTCCGGCGTCGCTTCCGGTGAACGTGCCGGACTGGTCGAAGATTCTCGGCGATGAGTACGGACGGAACCAGAGGAGGAACTACGACGACGACGACGAAGCGCGGAGCGATGAGGAAGATGGAGTTGGGAGAGTGCCTCCGCACGAGTTTCTGGCGAGGACGAGAATCGCTTCGTTCTCGGTGCACGAAGGAGTTGGGAGGACTCTCAAAGGACGCGATCTCAGTAGGGTTCGAAACGCGATTTGGGCTAAAACGGGATTCCAGGACTAG
Predicted protein sequences of Glyma13g40090
>Glyma13g40090.1   sequence type=predicted peptide   gene model=Glyma13g40090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATNIRRATYRFLPAMDTDSFSDSTFEFHESDLYNSARANSPELAKSVRSSRFHNYSSSSAARVGAPASLPVNVPDWSKILGDEYGRNQRRNYDDDDEARSDEEDGVGRVPPHEFLARTRIASFSVHEGVGRTLKGRDLSRVRNAIWAKTGFQD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo