Glyma13g36880 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g36880): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g36880): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g36880

Feature Type:	gene_model
Chromosome:	Gm13
Start:	38111668
stop:	38112493
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g36880

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G06260	AT	Annotation by Michelle Graham. TAIR10: Cysteine proteinases superfamily protein \| chr1:1916449-1917585 FORWARD LENGTH=343	SoyBase	E_val: 6.00E-42	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0008234	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cysteine-type peptidase activity	SoyBase	N/A	ISS
PTHR12411	Panther	CYSTEINE PROTEASE FAMILY C1-RELATED	JGI		ISS
PTHR12411:SF44	Panther	CATHEPSIN L-RELATED	JGI		ISS
PF00112	PFAM	Papain family cysteine protease	JGI		ISS
UniRef100_G7ZUL7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cysteine proteinase n=1 Tax=Medicago truncatula RepID=G7ZUL7_MEDTR	SoyBase	E_val: 2.00E-66	ISS
UniRef100_I1M3N8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1M3N8_SOYBN	SoyBase	E_val: 2.00E-85	ISS

Expression Patterns of Glyma13g36880

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g36880 not represented in the dataset	Glyma13g36880 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g36880

Paralog	Evidence	Comments
Glyma12g33581	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g36880 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g292900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g36880

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g36880

Limit To All Plant Sequences

>Glyma13g36880.2   sequence type=CDS   gene model=Glyma13g36880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGACAACAATAACATTAAGTGTTCCTATCATCAATCTTCTTGTCTTGAGCAATCTATGGATAACTGCAAGTGCATGTCCTGAAAATTCATCTGATTCAGAAATAAGGAGGAAGAGGTATGAAAGTTGGCTGAAAGAATATGCACGAAAATACGGGAACAAAGATCAATGGGAAGTCCATTTTGAAATTTACCGAAGGTCTACAACTCTCAAAAACTATGCTTACAAGCTCACAGACAACAAGTTTGCAGATCTTACAAATGTAGAGTTTAGATGTATGTATCTGGGTTATCGACCTATGTTGCATTTGCAGACAGGATTCATGTACCAAAAACATGGGGATCTACCAAAAAGCATAGATTGGAGGAGAAGAGGTGCAGTTACACATATCAAGGATCAAGGCCATGTTGGAAGTTGTTGGGCATTCTCTGAAGTGGAAGGCATCAAAAAAATAAAAACAGGAAAGCTGGTTTCTCTTTCAGAACAACAACTGATAGACTGTGATAGACTGGGGTGA

Predicted protein sequences of Glyma13g36880

Limit To All Plant Sequences

>Glyma13g36880.2   sequence type=predicted peptide   gene model=Glyma13g36880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKTTITLSVPIINLLVLSNLWITASACPENSSDSEIRRKRYESWLKEYARKYGNKDQWEVHFEIYRRSTTLKNYAYKLTDNKFADLTNVEFRCMYLGYRPMLHLQTGFMYQKHGDLPKSIDWRRRGAVTHIKDQGHVGSCWAFSEVEGIKKIKTGKLVSLSEQQLIDCDRLG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain