SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g34690

Feature Type:gene_model
Chromosome:Gm13
Start:36234132
stop:36236541
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g34690
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G53230AT Annotation by Michelle Graham. TAIR10: TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 3 | chr1:19850260-19851435 REVERSE LENGTH=391 SoyBaseE_val: 2.00E-77ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0045962GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of development, heterochronic SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PF03634PFAM TCP family transcription factor JGI ISS
UniRef100_E2FYM1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lanceolate n=1 Tax=Capsicum annuum RepID=E2FYM1_CAPAN SoyBaseE_val: 9.00E-98ISS
UniRef100_UPI000233B92CUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B92C related cluster n=1 Tax=unknown RepID=UPI000233B92C SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g34690
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g34690
ParalogEvidenceComments
Glyma12g35720 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g34690 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g271700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g34690
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g34690
>Glyma13g34690.2   sequence type=CDS   gene model=Glyma13g34690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGGTACACATGCAGGAACGACGTCGTCCAGCCAGGGGATGGTGAGAGGAAGCGGAGGGGAGATAGTTCAAGTTGAAGGCGGTCACATTGTGCGCTCCACAGGGCGGAAGGACCGTCACAGCAAAGTGTGCACCGCCAAAGGCCCTCGTGACCGACGGGTGAGGTTATCGGCCCACACCGCCATCCAATTCTACGACGTCCAGGACCGCTTGGGCTACGACCGCCCCAGCAAGGCCGTCGACTGGCTCATCAACAAGGCCAAGTCCTCCATCGACCAACTCGCCCACCTCCCTCCCTGGAAACCCACTCTCCCCTCACCCGCACCACCTCATCTAAACGACGACCATTCAGACAAACCTAACCCTAACCCTAACCCTAACCCCAACCCCAACCCCAACCCCAACCATAGCCCTGATGCCCAAATTCTCAACCAGTTCGACCACGACGATGGAGCTGGAGCTGGTTCCAGTTATCTTCCTATGGATAACGACGCGATAAGGTCGTTCTTCCCCACGACGACTTCCTCGTTGGTTCAATTCCAGAGCTACCCACCGGATTTGCTCTCCAGAACCAGTAGCCAGGACCTGCGTCTCTCGCTTCAGTCCTTGCAAGACCCTATTTTACTTCACCACAACCACAACAACAACGAGCACGTGCTTTTCGCTGGAACCGCCTTTGATAACATGGTAGCGTGGAATAATAATAGTAATAATAATCATAATAATAATAATCATAATAATAATAATAATAATAATAATAATAATAATACTGCTTCTAATGATACTTGTGGTGGTGGTGGTGGTGGTGGTGGAGGAGGAGGAGGAGGAGGAGGAGGGTTTGTGTTTAACGCTCCTTCGACTTTGCCGGGGCCGGCGACGGTGGCGTCGCCGACGGTGGTGTTTGGTCATGGTTATGGTCAAGGCCAGTATTTTTCTCAGAGGGGACCCCTTCAGTCCAGTAACAGCCCTTCCGTTCGTGCGTGGATTGACGCGCCATCGTTCGTCGCTGCTGCCGCCGATCATCGGCATCATCACTATCTGTCTCCCGCGGCAGCGGCAGCGGCGTTGGTGTATCAGTCTGCTCCTCCCACGGCGGCATTTACGGCGGCGCCCGGTGGCTTCTCGGGATTCCGCGTGCCGGCACGAATTCAGGGTGAGGAGGAGCACGACGGCGGCATGTCCGATAAGCCGTCCTCTGCTTCCTCCGATTCTCGCCGTTGA
Predicted protein sequences of Glyma13g34690
>Glyma13g34690.2   sequence type=predicted peptide   gene model=Glyma13g34690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGTHAGTTSSSQGMVRGSGGEIVQVEGGHIVRSTGRKDRHSKVCTAKGPRDRRVRLSAHTAIQFYDVQDRLGYDRPSKAVDWLINKAKSSIDQLAHLPPWKPTLPSPAPPHLNDDHSDKPNPNPNPNPNPNPNPNHSPDAQILNQFDHDDGAGAGSSYLPMDNDAIRSFFPTTTSSLVQFQSYPPDLLSRTSSQDLRLSLQSLQDPILLHHNHNNNEHVLFAGTAFDNMVAWNNNSNNNHNNNNHNNNNNNNNNNNTASNDTCGGGGGGGGGGGGGGGGFVFNAPSTLPGPATVASPTVVFGHGYGQGQYFSQRGPLQSSNSPSVRAWIDAPSFVAAAADHRHHHYLSPAAAAAALVYQSAPPTAAFTAAPGGFSGFRVPARIQGEEEHDGGMSDKPSSASSDSRR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo