SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G56400 | AT | Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 70 | chr3:20909082-20910409 REVERSE LENGTH=294 | SoyBase | E_val: 8.00E-33 | ISS |
| GO:0000165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: MAPK cascade | SoyBase | N/A | ISS |
| GO:0001666 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to hypoxia | SoyBase | N/A | ISS |
| GO:0002679 | GO-bp | Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response | SoyBase | N/A | ISS |
| GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0009409 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cold | SoyBase | N/A | ISS |
| GO:0009595 | GO-bp | Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus | SoyBase | N/A | ISS |
| GO:0009617 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to bacterium | SoyBase | N/A | ISS |
| GO:0009625 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to insect | SoyBase | N/A | ISS |
| GO:0009627 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance | SoyBase | N/A | ISS |
| GO:0009697 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009751 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus | SoyBase | N/A | ISS |
| GO:0009753 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus | SoyBase | N/A | ISS |
| GO:0009759 | GO-bp | Annotation by Michelle Graham. GO Biological Process: indole glucosinolate biosynthetic process | SoyBase | N/A | ISS |
| GO:0009814 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction | SoyBase | N/A | ISS |
| GO:0009862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009863 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009864 | GO-bp | Annotation by Michelle Graham. GO Biological Process: induced systemic resistance, jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010120 | GO-bp | Annotation by Michelle Graham. GO Biological Process: camalexin biosynthetic process | SoyBase | N/A | ISS |
| GO:0010200 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to chitin | SoyBase | N/A | ISS |
| GO:0010310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0019684 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction | SoyBase | N/A | ISS |
| GO:0031347 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of defense response | SoyBase | N/A | ISS |
| GO:0031348 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response | SoyBase | N/A | ISS |
| GO:0035304 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation | SoyBase | N/A | ISS |
| GO:0042742 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to bacterium | SoyBase | N/A | ISS |
| GO:0043069 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death | SoyBase | N/A | ISS |
| GO:0043900 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process | SoyBase | N/A | ISS |
| GO:0045088 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response | SoyBase | N/A | ISS |
| GO:0045892 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0050832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to fungus | SoyBase | N/A | ISS |
| GO:0051707 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to other organism | SoyBase | N/A | ISS |
| GO:1900056 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of leaf senescence | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0003700 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0043565 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding | SoyBase | N/A | ISS |
| PF03106 | PFAM | WRKY DNA -binding domain | JGI | ISS | |
| UniRef100_G7IR30 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: WRKY transcription factor n=1 Tax=Medicago truncatula RepID=G7IR30_MEDTR | SoyBase | E_val: 1.00E-68 | ISS |
| UniRef100_I1M2Y4 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1M2Y4_SOYBN | SoyBase | E_val: 3.00E-112 | ISS |
| Locus | Gene Symbol | Protein Name |
|---|---|---|
| WRKY138 | WRKY Transcription Factor |
|
Glyma13g34281 not represented in the dataset |
Glyma13g34281 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.13g267700 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma13g34281.1 sequence type=CDS gene model=Glyma13g34281 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGAGAATCAGCCTTCAAATGGAAAAAGGGCAATGGAAGAAGAGCTGATCAAAGGGTGTGAGACAGCAAACCAGTTACTTGAAGTACTTGTTCATAAATCCAACACTACTCATGAAGATGTAGAACTAGAAGGGTCAGTGCAACCTTTGGTTGAAGATCTTGTGCGCAAGGTGTTGTGTTCATTCACAAATACCCTTTTGCTATTGAACACTAATAATATTAATGATGTCTCCAAATACACTATCAAAGATGCCCCTTCGTCCGTGAAATGTCCAGAGACTCAGGGTACGGATGAGGCTTGCAAGAGTTTCTTCCACGCTGAAAAACGAAGAGGGTGCTACAAGAGAAAATCAAGTGCACCAACATGGGAGACGAACAGCTCAATTCTGCTGGAAGATGGCTATGCATGGAGAAAATATGGACAAAAGATAACACTGAATGCAAAATACCTCAGGAGCTACTACAGATGCACTCACAAGTATGATCAGGGTTGTCCAGCAACCAAACAGGTTCAGAGAACTCAAGAGGACCCTCCATTGTACCGGACAACATATTATGGACATCACAATTGCAAAAGCTCTTTAAGTCCTGAGATAATGATGGAACCAGCTTTTTCTTCTGGCTCTTCTATGATCCTTAGCTTCACTAGCACCCTCACAAGCAAAGAAGGATACCCATTTTCATCATCACTTTCTTCATCCACAAAACTGGAGCCTATGGAAGTGATTCAGGATGACCATATCGTTCAGAACCAATTATCCTCATCAGATTACCTCCTGTTATCTGACTATGGACTTGATTTCAATTATTAG
>Glyma13g34281.1 sequence type=predicted peptide gene model=Glyma13g34281 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MENQPSNGKRAMEEELIKGCETANQLLEVLVHKSNTTHEDVELEGSVQPLVEDLVRKVLCSFTNTLLLLNTNNINDVSKYTIKDAPSSVKCPETQGTDEACKSFFHAEKRRGCYKRKSSAPTWETNSSILLEDGYAWRKYGQKITLNAKYLRSYYRCTHKYDQGCPATKQVQRTQEDPPLYRTTYYGHHNCKSSLSPEIMMEPAFSSGSSMILSFTSTLTSKEGYPFSSSLSSSTKLEPMEVIQDDHIVQNQLSSSDYLLLSDYGLDFNY*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
