|
A newer version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT5G35530 | AT | Annotation by Michelle Graham. TAIR10: Ribosomal protein S3 family protein | chr5:13710355-13712192 REVERSE LENGTH=248 | SoyBase | E_val: 8.00E-10 | ISS |
GO:0001510 | GO-bp | Annotation by Michelle Graham. GO Biological Process: RNA methylation | SoyBase | N/A | ISS |
GO:0006412 | GO-bp | Annotation by Michelle Graham. GO Biological Process: translation | SoyBase | N/A | ISS |
GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
GO:0005622 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: intracellular | SoyBase | N/A | ISS |
GO:0005730 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleolus | SoyBase | N/A | ISS |
GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
GO:0005829 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosol | SoyBase | N/A | ISS |
GO:0005840 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: ribosome | SoyBase | N/A | ISS |
GO:0009506 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma | SoyBase | N/A | ISS |
GO:0015935 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: small ribosomal subunit | SoyBase | N/A | ISS |
GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
GO:0022626 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome | SoyBase | N/A | ISS |
GO:0022627 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit | SoyBase | N/A | ISS |
GO:0003723 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: RNA binding | SoyBase | N/A | ISS |
GO:0003735 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome | SoyBase | N/A | ISS |
UniRef100_B7FH64 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: 40S ribosomal protein S3 n=1 Tax=Medicago truncatula RepID=B7FH64_MEDTR | SoyBase | E_val: 4.00E-09 | ISS |
UniRef100_C6TAZ8 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TAZ8_SOYBN | SoyBase | E_val: 1.00E-09 | ISS |
Glyma13g33630 not represented in the dataset |
Glyma13g33630 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Corresponding Name | Annotation Version | Evidence | Comments |
---|
Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma13g33630.1 sequence type=CDS gene model=Glyma13g33630 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATCAAGGTTAAGATCATGCTTGATTGGGATCCTAAAGGGAAACAGGGTCCTAAAACTCCCCTTCCTGATCTT
>Glyma13g33630.1 sequence type=predicted peptide gene model=Glyma13g33630 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high IKVKIMLDWDPKGKQGPKTPLPDL
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||