SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g33571

Feature Type:gene_model
Chromosome:Gm13
Start:35369989
stop:35372116
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g33571
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G14580AT Annotation by Michelle Graham. TAIR10: Pentatricopeptide repeat (PPR) superfamily protein | chr3:4903012-4904229 FORWARD LENGTH=405 SoyBaseE_val: 3.00E-24ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PTHR24015Panther FAMILY NOT NAMED JGI ISS
PF01535PFAM PPR repeat JGI ISS
UniRef100_B9S6Q4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pentatricopeptide repeat-containing protein, putative n=1 Tax=Ricinus communis RepID=B9S6Q4_RICCO SoyBaseE_val: 6.00E-22ISS
UniRef100_UPI000233B7CAUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B7CA related cluster n=1 Tax=unknown RepID=UPI000233B7CA SoyBaseE_val: 3.00E-86ISS

Expression Patterns of Glyma13g33571
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g33571 not represented in the dataset
Glyma13g33571 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g33571
ParalogEvidenceComments
Glyma15g39390 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g33571 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g261100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g33571
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g33571
>Glyma13g33571.1   sequence type=CDS   gene model=Glyma13g33571   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGTTGGAGGGGTGGAAGCCGATGTGGCGGTGTACAATGTGTTGATTGGGGGGTTGAGGAAAGTGGGGAGGGTGTTGGAGGGGATGGTGAGGAGAGGGGTGTGTCCCAATGAGGTGTTGTGTGGGTTGGTGGAGAAGGGGAGGGTTGAGGAGGGGAAAGGGGTTGTGGAGAGGATGGGGAAGGAGGGGTTTGTGCCTAGCTTTGGGGCTTATAAGGGTTTGGTTAAGGGGTTTTGTGAGAAGGGAAGGATTGGGGAGGTGGAGTGGGTTGTTAGGGATATGGTATGGAAGGGGTTTGTGCCCAAGATGGGGATGCGGAGGAGGATTGTGAAATGTGTTGTTGAAAGGGAAAGGAGTGATGAGTGGGTGGCTGGTGCCATTGATGGAGTTTTTGAGGATTAA
Predicted protein sequences of Glyma13g33571
>Glyma13g33571.1   sequence type=predicted peptide   gene model=Glyma13g33571   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVGGVEADVAVYNVLIGGLRKVGRVLEGMVRRGVCPNEVLCGLVEKGRVEEGKGVVERMGKEGFVPSFGAYKGLVKGFCEKGRIGEVEWVVRDMVWKGFVPKMGMRRRIVKCVVERERSDEWVAGAIDGVFED*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo