SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g31681

Feature Type:gene_model
Chromosome:Gm13
Start:34069386
stop:34074981
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g31681
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G61120AT Annotation by Michelle Graham. TAIR10: terpene synthase 04 | chr1:22523689-22528598 FORWARD LENGTH=877 SoyBaseE_val: 1.00E-71ISS
GO:0000304GO-bp Annotation by Michelle Graham. GO Biological Process: response to singlet oxygen SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0016102GO-bp Annotation by Michelle Graham. GO Biological Process: diterpenoid biosynthetic process SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0080027GO-bp Annotation by Michelle Graham. GO Biological Process: response to herbivore SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0000287GO-mf Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding SoyBaseN/AISS
GO:0010333GO-mf Annotation by Michelle Graham. GO Molecular Function: terpene synthase activity SoyBaseN/AISS
GO:0016829GO-mf Annotation by Michelle Graham. GO Molecular Function: lyase activity SoyBaseN/AISS
GO:0080013GO-mf Annotation by Michelle Graham. GO Molecular Function: (E,E)-geranyllinalool synthase activity SoyBaseN/AISS
PF01397PFAM Terpene synthase, N-terminal domain JGI ISS
PF03936PFAM Terpene synthase family, metal binding domain JGI ISS
UniRef100_G7INZ1UniRef Annotation by Michelle Graham. Most informative UniRef hit: S-linalool synthase n=1 Tax=Medicago truncatula RepID=G7INZ1_MEDTR SoyBaseE_val: 5.00E-119ISS
UniRef100_I1M293UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1M293_SOYBN SoyBaseE_val: 2.00E-153ISS

Expression Patterns of Glyma13g31681
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g31681 not represented in the dataset
Glyma13g31681 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g31681 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma13g31681
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g31681
>Glyma13g31681.1   sequence type=CDS   gene model=Glyma13g31681   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCAAAAATCAAAACCCTGCAGGCTTCTGGGGAGATTGTGATGCCTTTGGTCATCCACCCATTGAAACTATTCCTGCCACTATTGCTTCCATGTTGGCTGTTAAGCAGTACAAAACAGGCGCATTAACAATTCAGAAAGTTATTAATATTTTAGGGGACACCCCACTCGGGGGACCATTAGCTGATCAGAATTACGTGAAACAAGAATCATGGATAAAACCAAGTACCATGCTTGCACCGCAGCTTCACAAAGACTCTCTAGCATTCCAACTCTTGCGCAATCATGGCTACAAAGTATCATCATCGAGTTTGTGTTGGTTTTTACATGACGAAGAAATTCGAGGTCTTGTTGAAAAGGATTATGAGTTCTTCTCAAGCACAATGGTTAACACCTACGGAGCGTCAAATCTTATGTTCTGCGGAGAATGTGAAATTAATTACGAGTTGAATATATCATGGATTGCTCGTCTGGATCATTTGGAATACAGAATGTGGATCGAAGAAAATGAAGCCAATGCCCTGTCGAAAGGAAAGACCTCGTATAACAGGATATCACACCTGCATAATGATCAGCTGCTTCAACTTGCGATCGAAAACTATGAGTTAAAGCAATCAATTTACAAAAAGGAGCTGGAAGAACTAAAGTGCTACCTTGCTATAGCTGCTGCCACTTCCGTCCCACATGACTCTTACATACGAATGTTAGTGGCCAAGAGTGCTATAATAATCACAGTTGCAGATGATTTCTATGACTTGGAAGGCCTCACTGATGCATATGGCCACAGCAAAGTCATATTCCAAGCTCTGGATAATCTTGTGAGTGAAGCTTCTACCAAGTACCTTCAACAAGTTGGAATTTATGATGACATAACTAACAGCATGCAAGATCTTTGGTATGAAACATTCTATTCTTGTCTCATAGAAGCAAAGTGGAGCAAAACGGGACAAACACCATCATTAGATAACTACCTCAAATATGGCATGATCTCCATTGCTGTTCATACATTGGTGCTTCCAGCCTCATGGGAAAATAAACAGAGTTTTGGTGAACATGGTAGAGGACCAGAGTCAAGTATTGAAGAATCGATTGCTTTAGTGACAGAGATGATCCATAAAAAGAAGAAAGAGTTGCTTGAACATGTCCTTATTGAAGGACATTCTGATTTGCCCAAGGCTAGCAATCATCTCCAGCTGTCATGTCTCACAATGCTTCAAGATATCAGCAAAGCAATCTACCTTCCTTTGAGTAAAAAATCAAAGCCACTTGATGTTGTTCCTCTCCAATCAGTGCCAAAGGAAAAAACACCAATACCAGTCTCAAAGCAAATCGTGCTTTAA
Predicted protein sequences of Glyma13g31681
>Glyma13g31681.1   sequence type=predicted peptide   gene model=Glyma13g31681   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFKNQNPAGFWGDCDAFGHPPIETIPATIASMLAVKQYKTGALTIQKVINILGDTPLGGPLADQNYVKQESWIKPSTMLAPQLHKDSLAFQLLRNHGYKVSSSSLCWFLHDEEIRGLVEKDYEFFSSTMVNTYGASNLMFCGECEINYELNISWIARLDHLEYRMWIEENEANALSKGKTSYNRISHLHNDQLLQLAIENYELKQSIYKKELEELKCYLAIAAATSVPHDSYIRMLVAKSAIIITVADDFYDLEGLTDAYGHSKVIFQALDNLVSEASTKYLQQVGIYDDITNSMQDLWYETFYSCLIEAKWSKTGQTPSLDNYLKYGMISIAVHTLVLPASWENKQSFGEHGRGPESSIEESIALVTEMIHKKKKELLEHVLIEGHSDLPKASNHLQLSCLTMLQDISKAIYLPLSKKSKPLDVVPLQSVPKEKTPIPVSKQIVL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo