Glyma13g31165 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g31165

Feature Type:	gene_model
Chromosome:	Gm13
Start:	33623751
stop:	33624122
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g31165

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G28270	AT	Annotation by Michelle Graham. TAIR10: ralf-like 4 \| chr1:9883165-9883497 FORWARD LENGTH=110	SoyBase	E_val: 4.00E-25	ISS
GO:0007267	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell-cell signaling	SoyBase	N/A	ISS
GO:0009827	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification	SoyBase	N/A	ISS
GO:0009860	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen tube growth	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0004871	GO-mf	Annotation by Michelle Graham. GO Molecular Function: signal transducer activity	SoyBase	N/A	ISS
PF05498	PFAM	Rapid ALkalinization Factor (RALF)	JGI		ISS
UniRef100_C6TM14	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=2 Tax=Glycine max RepID=C6TM14_SOYBN	SoyBase	E_val: 7.00E-86	ISS
UniRef100_G7ZYF5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: RALF n=1 Tax=Medicago truncatula RepID=G7ZYF5_MEDTR	SoyBase	E_val: 1.00E-30	ISS

Expression Patterns of Glyma13g31165

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g31165 not represented in the dataset	Glyma13g31165 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g31165

Paralog	Evidence	Comments
Glyma15g08170	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g31165 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma13g31165

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g31165

Limit To All Plant Sequences

>Glyma13g31165.1   sequence type=CDS   gene model=Glyma13g31165   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTTCCAAAGCATGGCTTGTGTTCCTTCTCCTGGCACTGGCCATGGTGGCTGAAACATATGCCACAATAGATGAATTTGCATCTACAACAATAGAAGAATTTGACTCTATTATCTCTAACGGTGATGCTGATCTCATTGTAGATGACAATGAGTTTTTGATGAGTTCAGAATCAACACCTCGGTCACTGATGCATGGCCATCCTGGAAAAGGCAGAGCTAGGTACATCAGCTATGCAGCCCTTAGAAGTAACCAGATACCATGCGGTAGGCGTGGACGTTCCTACTACAATTGCAACGAAAGGGGTAGGGCAAACCCTTACAGTCGTGGTTGCATTGCCATCACACACTGTGCCAGAGACACCAGTTAG

Predicted protein sequences of Glyma13g31165

Limit To All Plant Sequences

>Glyma13g31165.1   sequence type=predicted peptide   gene model=Glyma13g31165   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSKAWLVFLLLALAMVAETYATIDEFASTTIEEFDSIISNGDADLIVDDNEFLMSSESTPRSLMHGHPGKGRARYISYAALRSNQIPCGRRGRSYYNCNERGRANPYSRGCIAITHCARDTS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain