SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g30560): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g30560): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g30560

Feature Type:gene_model
Chromosome:Gm13
Start:33144571
stop:33147208
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G18480AT Annotation by Michelle Graham. TAIR10: P-loop containing nucleoside triphosphate hydrolases superfamily protein | chr4:10201897-10203361 REVERSE LENGTH=424 SoyBaseE_val: 0ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0006779GO-bp Annotation by Michelle Graham. GO Biological Process: porphyrin-containing compound biosynthetic process SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0010007GO-cc Annotation by Michelle Graham. GO Cellular Compartment: magnesium chelatase complex SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016851GO-mf Annotation by Michelle Graham. GO Molecular Function: magnesium chelatase activity SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
PF01078PFAM Magnesium chelatase, subunit ChlI JGI ISS
UniRef100_P93162UniRef Annotation by Michelle Graham. Most informative UniRef hit: Magnesium-chelatase subunit ChlI, chloroplastic n=1 Tax=Glycine max RepID=CHLI_SOYBN SoyBaseE_val: 0ISS
UniRef100_P93162UniRef Annotation by Michelle Graham. Best UniRef hit: Magnesium-chelatase subunit ChlI, chloroplastic n=1 Tax=Glycine max RepID=CHLI_SOYBN SoyBaseE_val: 0ISS

LocusGene SymbolProtein Name
Y11 Chl1a magnesium chelatase subunit 1a

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g30560 not represented in the dataset

Glyma13g30560 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma15g08680 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g232500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g30560.1   sequence type=CDS   gene model=Glyma13g30560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCCGCCTTGGGCACTTCTTCAATTGCGGTTCTGCCTTCGCGCTACTTCTCTTCTTCTTCTTCCAAGCCTTCCATTCACACTCTCTCTCTAACTTCAGGGCAGAACTATGGGCGGAAGTTTTATGGAGGAATTGGAATCCATGGCATAAAGGGAAGGGCTCAGCTCTCGGTTACCAATGTTGCCACTGAAGTTAACTCTGTAGAACAGGCTCAGAGTATTGCTTCTAAAGAAAGCCAGAGGCCAGTATACCCATTTTCTGCCATAGTTGGACAAGATGAGATGAAGCTTTGTCTTCTCCTTAATGTGATTGATCCTAAGATTGGAGGTGTAATGATCATGGGGGATAGGGGCACAGGGAAATCTACAACGGTCAGGTCATTGGTTGATTTACTTCCCGAAATCAAGGTTGTTGCTGGTGACCCTTATAACTCAGACCCACAAGATCCAGAATTCATGGGTGTTGAAGTCAGAGAGCGTGTACTTCAAGGAGAGGAACTTTCTGTTGTCTTGACCAAAATTAACATGGTTGATTTGCCATTGGGAGCTACAGAAGATAGAGTGTGTGGAACGATTGACATTGAGAAAGCCCTGACTGAGGGTGTCAAGGCATTTGAGCCTGGACTACTGGCTAAAGCTAATAGGGGAATCTTATATGTTGATGAAGTTAATCTTTTGGATGATCACTTGGTGGATGTGTTGTTGGATTCTGCTGCATCAGGATGGAACACAGTAGAGAGAGAGGGAATTTCTATCTCGCATCCTGCACGGTTTATCCTAATTGGCTCAGGCAACCCCGAAGAAGGGGAGCTCCGGCCGCAGCTGCTAGATAGGTTTGGAATGCATGCTCAAGTTGGAACTGTTAGGGATGCTGAGCTCAGAGTGAAGATTGTGGAGGAGAGAGGTCGATTTGACAAAAATCCAAAGGAATTTCGAGATTCTTACAAAGCTGAGCAAGAGAAGCTCCAACAACAAATTACCTCAGCAAGGAGTGTTCTTTCTTCTGTTCAAATTGATCAAGATCTCAAGGTGAAAATCTCCAAGGTGTGTGCTGAGTTGAATGTGGATGGATTAAGAGGAGACATAGTAACAAATAGAGCTGCAAAAGCTCTGGCTGCTCTGAAGGGAAGAGACAACGTAAGTGCCGAGGATATTGCTACTGTCATCCCTAACTGCTTGAGACACCGTCTTAGAAAGGATCCCTTGGAGTCTATAGACTCAGGTTTACTTGTCACTGAGAAATTTTATGAGGTATTCAGCTGA

>Glyma13g30560.1   sequence type=predicted peptide   gene model=Glyma13g30560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASALGTSSIAVLPSRYFSSSSSKPSIHTLSLTSGQNYGRKFYGGIGIHGIKGRAQLSVTNVATEVNSVEQAQSIASKESQRPVYPFSAIVGQDEMKLCLLLNVIDPKIGGVMIMGDRGTGKSTTVRSLVDLLPEIKVVAGDPYNSDPQDPEFMGVEVRERVLQGEELSVVLTKINMVDLPLGATEDRVCGTIDIEKALTEGVKAFEPGLLAKANRGILYVDEVNLLDDHLVDVLLDSAASGWNTVEREGISISHPARFILIGSGNPEEGELRPQLLDRFGMHAQVGTVRDAELRVKIVEERGRFDKNPKEFRDSYKAEQEKLQQQITSARSVLSSVQIDQDLKVKISKVCAELNVDGLRGDIVTNRAAKALAALKGRDNVSAEDIATVIPNCLRHRLRKDPLESIDSGLLVTEKFYEVFS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo