Report for Sequence Feature Glyma13g29950
Feature Type: gene_model
Chromosome: Gm13
Start: 32761746
stop: 32762758
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma13g29950
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G63310 AT
Annotation by Michelle Graham. TAIR10: unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20362.1); Has 78 Blast hits to 77 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:23486580-23487044 REVERSE LENGTH=154
SoyBase E_val: 8.00E-28 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_I1M1R4 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M1R4_SOYBN
SoyBase E_val: 8.00E-113 ISS
UniRef100_Q01HX1 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: B0616E02-H0507E05.1 protein n=2 Tax=Oryza sativa RepID=Q01HX1_ORYSA
SoyBase E_val: 3.00E-08 ISS
Expression Patterns of Glyma13g29950
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma13g29950
Paralog Evidence Comments
Glyma15g09150 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma13g29950 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.13g227300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma13g29950
Coding sequences of Glyma13g29950
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma13g29950.1 sequence type=CDS gene model=Glyma13g29950 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCCTTTTGAATCATCAGCCAAGTCTAGTCAATCTCCCCCTGCTGAAGGCGACAAGCACAAGCATTTGGACAGGGAAATTAGGGAGATGGTATCTGCCATCACTCACCGTGTAACTGATTTTCACAAAGCTGGCTCCACCCACCATTTGGAGAAAGAGCATGAAGATGACACGAGGATCATTACCCTCACAGGAACCAATGATGGAGCAACACTGCGAAGCGAATTGGATGAAAAATCGGGCAAAACTTCTCATGGTGAGTCTGAAGAATTGAGCACCTTTGTTAACAGCAACTTTCAGGCCATCAACAACTCCATCATGTTTGGTGGAAGTTACCAAGCCAATGACCCTGGTGTGCATTTGGATATCTCTGATTTCACTGATGACCAACCTCCTCAGAGCCAAAAACACAAGGTTGAGAAGCTAGGGAAGAAGGGAAAGAAAGAGAAAGAAGGTTCCAAAAGTGATCATCAATTTGGCTTTTAA
Predicted protein sequences of Glyma13g29950
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma13g29950.1 sequence type=predicted peptide gene model=Glyma13g29950 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MPFESSAKSSQSPPAEGDKHKHLDREIREMVSAITHRVTDFHKAGSTHHLEKEHEDDTRIITLTGTNDGATLRSELDEKSGKTSHGESEELSTFVNSNFQAINNSIMFGGSYQANDPGVHLDISDFTDDQPPQSQKHKVEKLGKKGKKEKEGSKSDHQFGF*