SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g29420

Feature Type:gene_model
Chromosome:Gm13
Start:32316767
stop:32319481
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g29420
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G18040AT Annotation by Michelle Graham. TAIR10: eukaryotic translation initiation factor 4E | chr4:10016724-10018151 REVERSE LENGTH=235 SoyBaseE_val: 7.00E-113ISS
GO:0006413GO-bp Annotation by Michelle Graham. GO Biological Process: translational initiation SoyBaseN/AISS
GO:0006626GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion SoyBaseN/AISS
GO:0009615GO-bp Annotation by Michelle Graham. GO Biological Process: response to virus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0000339GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA cap binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0003743GO-mf Annotation by Michelle Graham. GO Molecular Function: translation initiation factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG1670 KOG Translation initiation factor 4F, cap-binding subunit (eIF-4E) and related cap-binding proteins JGI ISS
PTHR11960Panther EUKARYOTIC TRANSLATION INITIATION FACTOR 4E RELATED JGI ISS
PF01652PFAM Eukaryotic initiation factor 4E JGI ISS
UniRef100_C6ZJZ3UniRef Annotation by Michelle Graham. Best UniRef hit: Eukaryotic translation initiation factor 4E n=1 Tax=Glycine max RepID=C6ZJZ3_SOYBN SoyBaseE_val: 5.00E-176ISS
UniRef100_C6ZJZ3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Eukaryotic translation initiation factor 4E n=1 Tax=Glycine max RepID=C6ZJZ3_SOYBN SoyBaseE_val: 5.00E-176ISS

Expression Patterns of Glyma13g29420
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g29420
ParalogEvidenceComments
Glyma15g09630 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g29420 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g222400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g29420
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g29420
>Glyma13g29420.1   sequence type=CDS   gene model=Glyma13g29420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTGTAGAAGATACCCAAAAGTCAGTCATCACGGAGGACCAATACCCTAGCAGGGTCGTCAGCGACAACAACAACGACGACGACGACGATGATCTCGAAGAGGGTGAGATCCCCGTCGACGGCGAAGATAGCGGCGCCACCGCCACAACGAAGCCTCCGGCCGCCCTCGCCCGAAACCCCCACCCTCTGGAGAATTCCTGGACCTTCTGGTTCGACAACCCTTCCTCCAAGTCCAAACAAGCCGCATGGGGCAGCTCCATCCGACCCATCTACACTTTCGCCACCGTTGAAGAGTTTTGGAGCATTTACAATAACATTCACCACCCGAGCAAGTTGGGTTTGGGGGCGGACTTTCACTGCTTCAAGCACAAGATTGAGCCAAAGTGGGAGGACCCTATCTGCGCCAATGGGGGAAAGTGGACTATGACCTTCCCAAGGGGAAAATCTGATACCAGTTGGTTGTATACGTTGTTGGCGATGATTGGAGAACAGTTTGATCACGGAGATGAAATATGTGGAGCTGTTGTGAATGTCAGAAGTAGGCAGGATAAAATTGCTATTTGGACTAAGAACGCTTCAAATGAAGCTGCTCAGGTGAGCATTGGAAAGCAGTGGAAGGAGTTTCTTGATTACAATGACACAATTGGCTTTATATTTCATGAGGATGCAAAGAAGCTGGACAGAGGTGCTAAAAATAAATACGTTGTATGA
Predicted protein sequences of Glyma13g29420
>Glyma13g29420.1   sequence type=predicted peptide   gene model=Glyma13g29420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVVEDTQKSVITEDQYPSRVVSDNNNDDDDDDLEEGEIPVDGEDSGATATTKPPAALARNPHPLENSWTFWFDNPSSKSKQAAWGSSIRPIYTFATVEEFWSIYNNIHHPSKLGLGADFHCFKHKIEPKWEDPICANGGKWTMTFPRGKSDTSWLYTLLAMIGEQFDHGDEICGAVVNVRSRQDKIAIWTKNASNEAAQVSIGKQWKEFLDYNDTIGFIFHEDAKKLDRGAKNKYVV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo