Warning : Undefined variable $sxsome in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $sstart in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $send in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g29011): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1019
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g29011): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1021
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1025
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1031
Report for Sequence Feature Glyma13g29011
Feature Type: gene_model
Chromosome: Gm13
Start: 31977629
stop: 31983969
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma13g29011
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G46210 AT
Annotation by Michelle Graham. TAIR10: cullin4 | chr5:18731569-18736653 REVERSE LENGTH=792
SoyBase E_val: 0 ISS
GO:0000209 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein polyubiquitination
SoyBase N/A ISS
GO:0006281 GO-bp
Annotation by Michelle Graham. GO Biological Process: DNA repair
SoyBase N/A ISS
GO:0006396 GO-bp
Annotation by Michelle Graham. GO Biological Process: RNA processing
SoyBase N/A ISS
GO:0006511 GO-bp
Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process
SoyBase N/A ISS
GO:0007049 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell cycle
SoyBase N/A ISS
GO:0007062 GO-bp
Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion
SoyBase N/A ISS
GO:0009640 GO-bp
Annotation by Michelle Graham. GO Biological Process: photomorphogenesis
SoyBase N/A ISS
GO:0009755 GO-bp
Annotation by Michelle Graham. GO Biological Process: hormone-mediated signaling pathway
SoyBase N/A ISS
GO:0009793 GO-bp
Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy
SoyBase N/A ISS
GO:0009845 GO-bp
Annotation by Michelle Graham. GO Biological Process: seed germination
SoyBase N/A ISS
GO:0009880 GO-bp
Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification
SoyBase N/A ISS
GO:0009908 GO-bp
Annotation by Michelle Graham. GO Biological Process: flower development
SoyBase N/A ISS
GO:0009909 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of flower development
SoyBase N/A ISS
GO:0009933 GO-bp
Annotation by Michelle Graham. GO Biological Process: meristem structural organization
SoyBase N/A ISS
GO:0010072 GO-bp
Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification
SoyBase N/A ISS
GO:0010100 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of photomorphogenesis
SoyBase N/A ISS
GO:0010154 GO-bp
Annotation by Michelle Graham. GO Biological Process: fruit development
SoyBase N/A ISS
GO:0010162 GO-bp
Annotation by Michelle Graham. GO Biological Process: seed dormancy process
SoyBase N/A ISS
GO:0010182 GO-bp
Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway
SoyBase N/A ISS
GO:0010228 GO-bp
Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem
SoyBase N/A ISS
GO:0010431 GO-bp
Annotation by Michelle Graham. GO Biological Process: seed maturation
SoyBase N/A ISS
GO:0010564 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process
SoyBase N/A ISS
GO:0016567 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein ubiquitination
SoyBase N/A ISS
GO:0019915 GO-bp
Annotation by Michelle Graham. GO Biological Process: lipid storage
SoyBase N/A ISS
GO:0022402 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell cycle process
SoyBase N/A ISS
GO:0045595 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation
SoyBase N/A ISS
GO:0048366 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf development
SoyBase N/A ISS
GO:0048367 GO-bp
Annotation by Michelle Graham. GO Biological Process: shoot development
SoyBase N/A ISS
GO:0048575 GO-bp
Annotation by Michelle Graham. GO Biological Process: short-day photoperiodism, flowering
SoyBase N/A ISS
GO:0048608 GO-bp
Annotation by Michelle Graham. GO Biological Process: reproductive structure development
SoyBase N/A ISS
GO:0048825 GO-bp
Annotation by Michelle Graham. GO Biological Process: cotyledon development
SoyBase N/A ISS
GO:0050826 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to freezing
SoyBase N/A ISS
GO:0051301 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell division
SoyBase N/A ISS
GO:0000151 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: ubiquitin ligase complex
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0031461 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cullin-RING ubiquitin ligase complex
SoyBase N/A ISS
GO:0080008 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: CUL4-RING ubiquitin ligase complex
SoyBase N/A ISS
GO:0004842 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0031625 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ubiquitin protein ligase binding
SoyBase N/A ISS
PTHR11932 Panther
CULLIN
JGI ISS
PTHR11932:SF53 Panther
SUBFAMILY NOT NAMED
JGI ISS
PF00888 PFAM
Cullin family
JGI ISS
UniRef100_G7IP79 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Cullin n=1 Tax=Medicago truncatula RepID=G7IP79_MEDTR
SoyBase E_val: 0 ISS
UniRef100_I1M1G1 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Papilionoideae RepID=I1M1G1_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma13g29011
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma13g29011
Paralog Evidence Comments
Glyma15g10030 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma13g29011 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.13g218500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma13g29011
Coding sequences of Glyma13g29011
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma13g29011.1 sequence type=CDS gene model=Glyma13g29011 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTCTCTCCCCACCAAACGGTCGAGCACCGCTGGTTCCTCCCTGTCGCCGCCACCTCCTATGAAAAAGGCCAAGTCCCTCCTCCTCCGCTCCTCCTCCGACGACCACGACGCCGTTTTGGACCCTTCCTCCATGCCTCTCGACGACGATCTCCCCAATGCCCGCGCCGCCAATCTCGCCCGCAAGAAAGCCACCCCGCCCCAACCCGCCAAGAAGCTCCTCATCAAGCTCCACAAAGCTAAACCAACATTGCCCACAAATTTCGAGGAGGATACATGGGCAAAACTAAAGTCTGCCATTTGTGCTATATTTTTGAAGCAACCTAACTCTTGTGACTTGGAGAAGCTTTATCAGGCTGTGAACGATCTCTGCCTTTATAAAATGGGTGGAAATCTTTATCAACGGATTGAAAAGGAGTGTGAAGCACATATATCTGCTGCACTGCAGTCTTTGGTTGGCCAAAGCCCAGATTTGGTTGTTTTTCTGTCTCTAGTTGAGAGATGTTGGCAGGATCTTTGTGACCAAATGTTGATGATTCGTGGTATAGCCTTGTATCTAGATAGGACATATGTGAAGCAAACAGCAAATGTCCGATCATTATGGGACATGGGCTTACAACTTTTCCGCAAACATCTTTCATTGTCTCCTGAAGTAGAACACAAAACTGTTACAGGTCTTCTACGAATGATTGAAAGTGAAAGAAAAGGTGAAGCAGTGGATAGAACTCTTCTAAACCACCTTTTGAAGATGTTTACTGCTCTGGGAATTTATGCAGAAAGCTTTGAGAAGCCATTCCTTGAATGCACATCTGAATTTTATGCTGCTGAAGGTGTGAAATACATGCAGCAATCAGATGTTCCAGATTACTTGAAGCATGTGGAGATACGATTGCAAGAAGAACATGAAAGATGTTTGATCTACTTGGATGCAAGTACTAGGAAGCCATTGATAGCAACAGCAGAAAAACAACTTCTTGAACGTCATATACCTGCCATTCTTGATAAGGGCTTTGCAATGCTTATGGATGGGAATCGTATTGAAGACCTTCAGAGAATGTACTCACTCTTTTCAAGGGTCAATGCCCTCGAGTCATTGAGGCAGGCCATTAGTTCATATATCAGGAGAACTGGTCAGGGCATTGTTTTGGACGAGGAGAAAGATAAGGATATGGTTTCATCCCTTTTGGAATTTAAGGCTTCTCTTGACACAACATGGGAAGAAAGCTTTTCCAAGAATGAAGCATTCTGTAACACCATCAAAGATTCGTTTGAGCATCTCATCAATCTTCGTCAGAACCGACCTGCTGAATTGATTGCCAAGTTTTTGGATGAGAAACTTCGTGCAGGTAACAAGGGCACTTCAGAAGAAGAGTTGGAGGGTACACTTGATAAAGTCCTTGTTTTATTCAGCTAA
Predicted protein sequences of Glyma13g29011
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma13g29011.1 sequence type=predicted peptide gene model=Glyma13g29011 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSLPTKRSSTAGSSLSPPPPMKKAKSLLLRSSSDDHDAVLDPSSMPLDDDLPNARAANLARKKATPPQPAKKLLIKLHKAKPTLPTNFEEDTWAKLKSAICAIFLKQPNSCDLEKLYQAVNDLCLYKMGGNLYQRIEKECEAHISAALQSLVGQSPDLVVFLSLVERCWQDLCDQMLMIRGIALYLDRTYVKQTANVRSLWDMGLQLFRKHLSLSPEVEHKTVTGLLRMIESERKGEAVDRTLLNHLLKMFTALGIYAESFEKPFLECTSEFYAAEGVKYMQQSDVPDYLKHVEIRLQEEHERCLIYLDASTRKPLIATAEKQLLERHIPAILDKGFAMLMDGNRIEDLQRMYSLFSRVNALESLRQAISSYIRRTGQGIVLDEEKDKDMVSSLLEFKASLDTTWEESFSKNEAFCNTIKDSFEHLINLRQNRPAELIAKFLDEKLRAGNKGTSEEELEGTLDKVLVLFS*