SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g28770

Feature Type:gene_model
Chromosome:Gm13
Start:31754447
stop:31761832
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g28770
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G39090AT Annotation by Michelle Graham. TAIR10: tetratricopeptide repeat (TPR)-containing protein | chr2:16312771-16317233 REVERSE LENGTH=558 SoyBaseE_val: 0ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0006259GO-bp Annotation by Michelle Graham. GO Biological Process: DNA metabolic process SoyBaseN/AISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007276GO-bp Annotation by Michelle Graham. GO Biological Process: gamete generation SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0008284GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cell proliferation SoyBaseN/AISS
GO:0009410GO-bp Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0032875GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA endoreduplication SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0043248GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome assembly SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048522GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cellular process SoyBaseN/AISS
GO:0051276GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome organization SoyBaseN/AISS
GO:0051302GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell division SoyBaseN/AISS
GO:0051510GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of unidimensional cell growth SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG1174 KOG Anaphase-promoting complex (APC), subunit 7 JGI ISS
PTHR12558Panther ANAPHASE PROMOTING COMPLEX SUBUNIT JGI ISS
PTHR12558:SF8Panther ANAPHASE PROMOTING COMPLEX SUBUNIT 7 JGI ISS
UniRef100_G7IPZ9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Anaphase-promoting complex subunit n=1 Tax=Medicago truncatula RepID=G7IPZ9_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1M1D5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M1D5_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g28770
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g28770
ParalogEvidenceComments
Glyma15g10290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g28770 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g216500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g28770
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g28770
>Glyma13g28770.1   sequence type=CDS   gene model=Glyma13g28770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGTTCCGAAGGATCAAATCGCCACTCTTCTCGAACATGGACTATACAACTCCGCTCAGATGCTCGGTTGTTTTCTTGTTTCTTCACCCGCTGTTAATGCTGAATCTGCCCCACACCTCAAAACTGAGAGCTTGGTGCTACTTGGTGATTCTTTCTTCCGTGAAAGGGAGTATCGTAGAGCCATTCACACCTACAAGCAAGCTTTGCAATGCTACAAGATGATTCCAAAACAGAACATGACATCTTCTCGGAGTTCATTGTCATCGAACCGGTCTTCGTCTCCGAATTCCTGCAATGGATCAGTGATCAATGAGAATGAGGTGAAGTTCAAAATTGCATCATGTCACAGTTTTCTGAACGAGAATAAAGCAGCTCTAGTTGAGATGGAAGGCATTCCAAGTAAAGCTAGAAATTTACCAATGAATTTGTTATTAGGGAGGCTCTATCGAATTTCTAGACATAGCCGAGCTGCTGTTGCTATTTACAAAGAATGTCTAAGACATTGTCCTTATGTTCTTGAGGCTATCACAGCTTTAGCAGAACTTGGGTCTACTGCAAAGGACATCATTTCATTGATTCCTCAGACTCTGAATAGAAGTGGTAGAGCTCCATTTGATCACACTGACTCAAGTCGTTGGCTTCAACGCTATGTTGAAGCTCAATGTTGCATGGCTTCAAATGATTATAAAGGTGGATTGGAACTCTTTGCAGATCTTTTACAGCGCTTCCCTAATAATATACACATAATACTTGAGATGGCAAAGGTTGAAGCTATTATTGGAAAGAATGAAGAGGCCATTATGAATTTTGAAAAGGCCCGATCAATTGATCCATACATCGTAACATATATGGATGAGTATGCAATGCTTCTAAAGCTAAAATCTGATTATCCAAAGCTGAATAAGTTAGTGCATGATTTATTGAATATTGATCCTGCAAGACCAGAGGTTTTTGTAGCTTTGTCTGTTTTATGGGAAAGGAAAGATGAGAAAAAAGCATTACAATATGCTGAGCAGAGTGTTCGGATCGATGAGAGGCACATACCAGGGTATATAATGAAGGGAAATTTATTATTGACGATGAAACGGGCAGAAGCAGCTGTTCCTGCCTTCAGAGCAGCTCAAGAATTGAGACCTGATATTCGCTCATATCAAGGTTTGGTCCATACATATTTGGCTCTCTCTAAAATCAAAGAGGCTTTATATGCTTCGAGAGAAGCAATGAAAGCAATGCCTCAGTCAGCAAAAGCTTTAAAATTAGTAGGTGATGTGCATGCCAGTAATTCTAGTGGCAGGGAAAAGGCTAAAAAATTCTACGAGTCTGCACTAAGACTGGAACCTGGTTACCTTGGAGCTGCACTAGCTTTGGCTGAGCTCCATGTTATCGAGGGCCGAAATGGAGATGCTGTGTCTCTGCTTGAGCGATATCTTAAAGACTGGGCTGATGATTCTCTTCATGTAAAACTTGCACAAGTTTTTGCAGCCACTAACATGCTGCAGGAGGCTTTGTCACATTATCAGGCTGCATTAAGGTTAAACCCCCAGAATGAAGCAGCAAAACGGGGTTTAGAGCGATTAGAGAAGCAAATGAAGGGAGTGGATCCTGATGCACCTGAAGAAGATGAAGACAATGATGTTGAAGATGCAGATGGAGATCAAGACGAGACTGAACTTCTGTGA
Predicted protein sequences of Glyma13g28770
>Glyma13g28770.1   sequence type=predicted peptide   gene model=Glyma13g28770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVPKDQIATLLEHGLYNSAQMLGCFLVSSPAVNAESAPHLKTESLVLLGDSFFREREYRRAIHTYKQALQCYKMIPKQNMTSSRSSLSSNRSSSPNSCNGSVINENEVKFKIASCHSFLNENKAALVEMEGIPSKARNLPMNLLLGRLYRISRHSRAAVAIYKECLRHCPYVLEAITALAELGSTAKDIISLIPQTLNRSGRAPFDHTDSSRWLQRYVEAQCCMASNDYKGGLELFADLLQRFPNNIHIILEMAKVEAIIGKNEEAIMNFEKARSIDPYIVTYMDEYAMLLKLKSDYPKLNKLVHDLLNIDPARPEVFVALSVLWERKDEKKALQYAEQSVRIDERHIPGYIMKGNLLLTMKRAEAAVPAFRAAQELRPDIRSYQGLVHTYLALSKIKEALYASREAMKAMPQSAKALKLVGDVHASNSSGREKAKKFYESALRLEPGYLGAALALAELHVIEGRNGDAVSLLERYLKDWADDSLHVKLAQVFAATNMLQEALSHYQAALRLNPQNEAAKRGLERLEKQMKGVDPDAPEEDEDNDVEDADGDQDETELL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo